how we help

Align Costs with Strategy & Focus on Growth

main principles

Global Reach with Local Understanding

In what areas do you provide management consulting?

Our associate consultants specialize in a range of business areas. These include strategic planning, issues resolution, culture assessment, board effectiveness, retention.

In which countries do you provide consulting services?

Our associate consultants specialize in a range of business areas. These include strategic planning, issues resolution, culture assessment, board effectiveness, retention.

How is a consulting project started and organized?

Our associate consultants specialize in a range of business areas. These include strategic planning, issues resolution, culture assessment, board effectiveness, retention.

our benefits

Why Clients Choose Us

ExifMM*bj(1r2i ' 'Adobe Photoshop CS6 (Windows)2019:03:04 11:13:18&(. HH Adobe_CMAdobed            P" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?& J\' ,o wn8 =o,~wmi)Nu7cZۃ3y.|I7E{Zz^s K}/{lLDi.ms `,v=You~3-Du^*o^z~phoϠͿOĔ,Α}?s^S͑[email protected]ƹkl6kM%)$IJQ$ruiC=4@R]wGJiu #n/$:nke~d>>g< 8l))GS$P1% okKlڙ#LyRpc];(;wIO& SJfZXꝌܒq4DKYVC]V@xz v]]c+e~տvz˦fS2[email protected]-og鿛"ȷu֊hln鹮5s7쭟jSY]ͪRO<}~ez;6z+1mv)O$$O纕=r/ }cv տmsZ?LenVfFUL%2~nU_Eo[ZZ0;чvƽ;O=eߡlEJīr* vM.s=2?I\տT0=2nglkF2{_c:,AsG H?eĔq"4Jb]GAv5 ˬsD#{ύko0rl88̝;.Y{u \1k[}b<7 .'L$9Veb(~;lMX7kw}r|A 4?dDCvvB*o~ ) dQ];}V=J|JzlsKMK[t_Q7':ݡA.پJФN JfDJJ.pkK  MȦ]kZṾ69)) |{~뺿@`w/؊$p#̕[:x'U0Kv%I)&F=Y<6kK^Kw4;,_eHlOׄ)~7cd_bu{\@1X3<)w? JX9rGLUzp˸k8X(>pw֟SbJlMs@TpR02ȭc.hsE,x]Sw\d㷙Lfds%-j/k{Cþp k)QPhotoshop 3.08BIMZ%G6 Basic RGB8BIM%h֡2ng8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjc Prova Ayar1 proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd [email protected]Grn [email protected]Bl [email protected]BrdTUntF#RltBld UntF#RltRsltUntF#[email protected] vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#[email protected]cropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIMHH8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM?17209nullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM P  Adobe_CMAdobed            P" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?& J\' ,o wn8 =o,~wmi)Nu7cZۃ3y.|I7E{Zz^s K}/{lLDi.ms `,v=You~3-Du^*o^z~phoϠͿOĔ,Α}?s^S͑[email protected]ƹkl6kM%)$IJQ$ruiC=4@R]wGJiu #n/$:nke~d>>g< 8l))GS$P1% okKlڙ#LyRpc];(;wIO& SJfZXꝌܒq4DKYVC]V@xz v]]c+e~տvz˦fS2[email protected]-og鿛"ȷu֊hln鹮5s7쭟jSY]ͪRO<}~ez;6z+1mv)O$$O纕=r/ }cv տmsZ?LenVfFUL%2~nU_Eo[ZZ0;чvƽ;O=eߡlEJīr* vM.s=2?I\տT0=2nglkF2{_c:,AsG H?eĔq"4Jb]GAv5 ˬsD#{ύko0rl88̝;.Y{u \1k[}b<7 .'L$9Veb(~;lMX7kw}r|A 4?dDCvvB*o~ ) dQ];}V=J|JzlsKMK[t_Q7':ݡA.پJФN JfDJJ.pkK  MȦ]kZṾ69)) |{~뺿@`w/؊$p#̕[:x'U0Kv%I)&F=Y<6kK^Kw4;,_eHlOׄ)~7cd_bu{\@1X3<)w? JX9rGLUzp˸k8X(>pw֟SbJlMs@TpR02ȭc.hsE,x]Sw\d㷙Lfds%-j/k{Cþp k)Q8BIM!UAdobe PhotoshopAdobe Photoshop CS68BIMohttp://ns.adobe.com/xap/1.0/ Basic RGB Cyan Magenta Yellow Black ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGG[email protected],AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ [email protected]و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~[email protected]~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPT[email protected]7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D[email protected]3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т[email protected]( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFz[email protected]{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl[email protected]Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>[email protected]{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-x[email protected] qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty[email protected] >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:[email protected]`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!M[email protected]?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖ[email protected]2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?h[email protected]LAAHoj5ʞi)ț ǍH}ww̷lϳaЮ|Vͪ&Kߥ,@蔬5g)s<{)@bRwHlKaP VV+Kx[email protected]mW5Z)`{}T],˃v3k̲]`᭯FUCK[email protected]`;5($)xq!-v_tcOvjkZ(`cUJפå@&4̞)c#䊇o}s|e*pt+ZzitOnuEfv:ۮ x-/yh#z.{ '~ @ oVye1OyZPz"O`zEe{B:ܭ|/Ȩ|$}l W[n o%e'jZ`4POݵR]E^:۫/ϧ$-6K. meߏDo dپZCOƴ;JEP$:תۄ/զ:$Aҟ8$ K0B oD0dY#OPE:)/ʥ$Q $ ^$nyRd+dYfO$Dέь:!/ċ$^{HI ^#nncǻ,Y9ÓNѱ D*:Pv/9$i|6]  )Ebn cnX+NODJ5:$ؔ/l$t@sg; Z.ZڋmͿtc# XN9D9Dy/xі$ ۚ k!mp1dbֺ%XU"M1C۫r9צƜ/jN$8 ϔɈ[ym֮rbǫHX YMȯƥCX9aN/_䜄$" FuoPvqw_rxsғxu*yYvmAzwYJzxD{Qz.{z{{Sܢsy>tz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv[email protected]ݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\[email protected]bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP[email protected]$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|t[email protected]vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM[email protected]u2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{[email protected]S׀.Ix[email protected]%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/[email protected]sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOg[email protected]jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{[email protected]{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)[email protected]Y2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}[email protected]E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}[email protected]v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ[email protected]߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧[email protected]fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#[email protected]o5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ[email protected]54gt*6!t=| vh$jBPkڥWWmEt8nepUDqnEr4sm!}sC v8ԮhiVkQql:skn(ndRoTpDr*3s!_s* 1u݈gGiE[jӁlLarmcoT=p}gD;q3r!FrĔk Muozc£zfq{*h{hk5v{m[f{oxV3|^quE:|sU3j}6u}v) [~w}x-lxn}5y.p#yqtzseKztU1{vDr{w[2|xM|SyP }|z߮avuvvfmwwEx!xskxxd1yAyTIyzCz{f2h{ |{;|x |}qtq~+\uN~\v~0v~rBw{~c3x! SxxCCyv1zz> "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~[email protected]F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdc[email protected]enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)Ȍ[email protected]ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd'[email protected]ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!Ʉ[email protected]ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}[email protected]}IpW~/<)~/ ~!|9">Rԁv(v[email protected]4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd[email protected]v|6֑w,Nx y%zx1}RVhdњ3x[xR yI[email protected]Q{6s{,| 썷}N~*É:|c~[>~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH [email protected]=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQ[email protected]aI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuy[email protected]XzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}[email protected];ad+fgއ q$MqQ&dWTRsXi9e[$X^ےIa;+d%H+egH gpLьP71TrcWeZ9W^I`;ct+ef̍ pcK\7 OxSUqVأ]dZ4#W9]mIQ`_:b+d4fi p[email protected]AhYq}jf] uk`xgymdcY?nfJ[pyi:qlB*[snsnojy-sc.^Se>ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSr[email protected]iJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}[email protected]_p7bt.xen$Xh#1j xl鉎rxzXޓ}[Pϒ^Ha?쏧dF7f.ij$)k>wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx[email protected] yL=ގz66Vz.k{&ыF|J0}cC~\ ۆ,+K}D~p= 6Us.y7&ŠsT ma0K(#DN[email protected]I5 4.Tg&]B% LH#wJCv<=5.3&ca x܆!҂B]J/0C-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}[email protected]cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_I[email protected]2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyy[email protected]zC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muU[email protected]Wjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} [email protected]}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{[email protected]dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=[email protected]m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhI[email protected]@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}[email protected])}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆ[email protected]"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuz[email protected]_mu2/aou#bq)iryv/HgXLiVsgOkEfS%mZ=VnMQYp?\r!1_Rs"`thu\IxxDo~1Hq2r)LryePEsYaTtLWu?BZv1L]8w"^xj(gyxx{A~x|ExqIyNdMyXQzjLUz>Y{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A [email protected]5[W)].a\k^`_xt[D^'jZH;N`?LUOKS[email protected]WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q[email protected]},i w!KjSxn(ye t{~A~fYWx<]A[xS^yJE`y@cPz76ez,tgb{x!Zh|)Kl| ks~fj}eW-~\Y~SB\~I_~@Ha6c=,ae!pgakk s } dUk[X+RZ˄I]q[email protected]`6b,\d!fSk r|]doŠ@[nV_RbYR[email protected]\?^ɉ6la{r,Zc!ez jm ;r>|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7[email protected]_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTL[email protected]Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |[email protected]wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~<[email protected]~7]y1yk+qy%$y[z,Z&zg<{d|:~%m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGG[email protected],AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GO[email protected]an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћo[email protected]T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢL[email protected]ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/[email protected]֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}[email protected]Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉ[email protected]HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO[email protected]B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[y[email protected]͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot[email protected]P2-$8'w̅{lڂe]߂JN񁦕[email protected]2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņ[email protected];iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠ[email protected]?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj[email protected](sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}[email protected] y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1N[email protected]C6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`y[email protected] zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<[email protected]Üq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs[email protected]GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLL[email protected]R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑp[email protected]}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm[email protected]ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZ[email protected]H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\[email protected]y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~[email protected]ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq[email protected]x;&4z`5|aJ~Te߷pM]0qkTrL?t [email protected]~u<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|[email protected] xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV[email protected]wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}[email protected]}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8[email protected]쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w[email protected]:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧ[email protected]"n93qK2s+wva$fKx{;R}z_Ek[email protected]m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;[email protected]MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?[email protected]y1wy"{yмgwjKil kn8mMo~oqoEpsp_ru(Ptv@vnx1WxJz"z8{dsOg7tiuukqv}omkwn9ohx^qkyOksrz@1uy{1wx||# y}Xb|te7|ng|]i}L|Ck}m>n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtE[email protected]R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { .[email protected]zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| [email protected]|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=yb[email protected]!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJ[email protected]ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoH[email protected]$+-^$[v4m>sdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~[email protected]^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/[email protected]oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yI[email protected]{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku<[email protected]o wHi4pxK\rbyPOt&zNCu{G6w|8*nyt} {'}Jh |>,i|k|tm}[email protected]}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\y[email protected]xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:[email protected]^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7[email protected]/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-[email protected]*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđ[email protected]CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN[email protected]&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@[email protected]`utoWu:NvEwG[email protected]+z`#{w|rp~pgq{c_crÐVsMu(EYvdg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHy[email protected]z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.[email protected]r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG [email protected]t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.[email protected]Q}LE~F:[email protected],: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝[email protected](d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb[email protected]%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Ka[email protected]#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv [email protected]xlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xx[email protected]"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`Dh[email protected]NBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#[email protected]܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|[email protected]<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|[email protected]}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mb[email protected]7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcY[email protected]iFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp][email protected]qNfsEitky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+[email protected]#Etwq/R[email protected]]xMaaTDe8y;i3flc+>p#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5u[email protected]wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/[email protected]qr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azl[email protected]yOa.e*Ti}&(ml!RqSu xg{[email protected]S[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!12[email protected]3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5[email protected]THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)[email protected]HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/B[email protected]UGYN\U_Zd_ڽ`s϶fįmsx}ĉLJdžƇƈĉÉÉÉÉÉÉÉÉÉ +8.C7M>VDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N[email protected]WAZEQ[Yn_einruxzponptvvvvvvvvvv ,9+E1P5Q8R9V6PCPYVm\}afim|pqvlkjjpqqqqqqqqqq,9)F-P0O1O.S)PARWTjX{]adgskjsgffeökllllllllll-:&G)M*K'K J.[email protected]VTWhWyY[]v`jedob~aЏaҠ`ԳefĿfĿfĿfĿfĿfĿfĿfĿfĿfĿ-;"I#H!D?!H5OGSZVkVyUUyVlYd`alazbۈbܖcܥcݷaĨaĨaĨaĨaĨaĨaĨaĨaĨaĨ-<HA2?'G;LNQ`QoP|O}PqRhVb\_f_q_|`އ`ߔaࢢa஡a஡a஡a஡a஡a஡a஡a஡a஡a஡.=@/4?.FAKSMcKqJ}KuLkNdR_X]_\h\q\{\⅞]㑝]㛜]㛜]㛜]㛜]㛜]㛜]㛜]㛜]㛜]㛜/> -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7[email protected]LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO[email protected]vIKtPWoWch`majwYt~T~RQPQQRRÅS̅Xτ[҄^ԃa؃dۂd܂d܂d܂d܂d܂d܂d܂d܂w sp.%r94[email protected]>{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%73[email protected]9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB[email protected];M>?N,<<0>:4?8[email protected];@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6[email protected]oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3I[email protected]YJڑaWщggɁnuyts{onoopqq̓sӓtӓuӔuӓuӓuӓuӓuӓuӓuӓuӓs oz$/9 A&H,N3S:ޞYCՖ_ȔfeĈlsrzxusrsttuƗvїwїwїwіwіwіwіwіwіwіwіt o}$/9A#G(M.S4ڢVAЛ]SȔeckqp~v{|wvwwxxyΛyΚyϚyϙyϙyϙyϙyϙyϙyϙyϙu p$/8@ G$M(ߪR-֦S?̠\QÙcaion|ty|zzzz{{̞{̞{͝{͜{͜{͜{͜{͜{͜{͜{͜u q$.8@F L#ܮM*ҩR=ȤZOa_hnmzrv|~}}}~~ɡ~ʡ}ˠ}̞}̞}̞}̞}̞}̞}̞}̞v r#.8?FKٲG(έP;ĨXM`]fllypty~|{ä{Ȥ}ɢ~ʡ~ʡ~ʡ~ʡ~ʡ~ʡ~ʡ~ʡw s#.7>DߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeB[email protected]`e>kdVC[email protected]IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P[email protected]0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+[email protected])[email protected])[email protected])[email protected])[email protected])[email protected])[email protected])[email protected])[email protected]yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-[email protected]dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/[email protected][Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYA[email protected][email protected][email protected][email protected][email protected][email protected][email protected]Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTB[email protected]WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5[email protected][email protected][email protected][@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*[email protected]JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"[email protected]*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1[email protected][M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$[email protected]+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5[email protected][_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|V[email protected]^McY~hczmmvrtsyyr|q}~r}}r~{r~yr~xr~yr|yr{zrzzrzzrzzrzzrzzrzY l{̝֜/œ=H P/W=\JbVfbkl{ot~wv{zu~wuuusurupvovցpvqu~rt|rt|rt|rt|rt|rt|\ o~ߚ ҟȡ-;FO-U;[H`Te_ijmsx}r|rzynykyjzhzgzfz҃gzhyjxjxjxjxjxjx_ r ֝͢å*9DM*T8ZE_Qc]ghzkrro{jveca`__ς_a~b}b}b}b}b}b}c v  ؙѠȦ(7 BK'R6XB]OaZ~eeuiolmxds^}\\[ZZ~Y~Z~\~\~\~\~\~\~gz  ܓӜˤª $4 ?H$O2U?ZK_Wxcboglfku^r{Z|~Y}X|X{WyVxUxVyWzWzWzWzWzWzl~֗ΡŨ0<E!L/RN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=B[email protected]G|@G?H>I>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:[email protected]LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W[email protected]^LcW{g`wli{trowrzttqurqvpqvorvmrvkrvkrulrsnqrnqqnqqnqqnqqnqq[ n { ٍғɗ(7 BK$R2X>]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnAD[email protected]ʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5A[email protected]v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`<[email protected]RsAR|BRBSBSBSBTBTCTCTCUDUDUFUGUGUHUHUHUHUHBP ^gmp$p+ o5 kBfL&`T3[\=XeCWnFWvGW~HWHWHWHXHXIXIYIYJYJYKYLYLZLZLZLZLZLEU clru v&v2 r?nI#hR0cZ<_aD\iI[qL[yM[N[N[N\N\N\O\O]O]P]Q]Q]Q]Q]Q]Q]Q]QI Y gpvy{ {0y=tHoP-jW9f^CbeK`mO_tQ_|S_S_S_T_T_T_U_U_U`V`V`U`U`U`U`U`UL ] j sy|̀.~<zFuN*qU7l\AibJfiQcpUbxWbXbXbYbYbYbZbZbZbZbZbYbYbYbYbYbYO ` m v |  ҂Ȅ,:D{M'wS4rZ?o`IjfQglWfsZe{\e]e]e^e^e^e_e_e_e^e]e]e]e]e]e]R cp y ~ւ͆Ĉ*8 CK$|R1xX=t^GpcPliWio\hw_gagbgb~gc}hc{gczgdyhcyhbyhayh`yh`yh`yh`yh`Ufs{؁цɉ(6 AJ"Q.}W:y\EuaNqfWnl]lsb|k{ezjfxjgvjgtjgsjhqjhpjgpkfqkdqjcqjcqjcqjcqjcWiu~Ԅ͉Ō&4@HO,U8~ZBz_LvdU}si^xpodtnwhqnjonkmnkknkjnkhnkgnjhniingjmfjmfjmfjmfjmf[lxفЇɌ #2>GN)T5[email protected]]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ[email protected]Ò[email protected]Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5[email protected]@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 [email protected]uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tX[email protected]{x^ItucRnrhYipo_enxbcncanc_nc^nc]ob\ob\n`\n_]n^^m]^m]^m]^m]^lw΀ņ+7 AHO)T4}X>v~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7m[email protected]]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A[email protected][email protected]/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 [email protected]cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 [email protected]|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^[email protected][clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^[email protected]|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: [email protected]jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ][email protected]YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z[email protected]$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuAR[email protected][email protected]^[email protected][email protected][email protected]kA|iAgAfAdAcA[email protected]`@`@`@[email protected][email protected]@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ [email protected] ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: [email protected] aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; [email protected]SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28[email protected]s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.[email protected]^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAA[email protected][email protected]IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\[email protected]Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@[email protected]&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8([email protected]&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:[email protected]C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?[email protected]EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98([email protected]'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>[email protected]4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?[email protected][email protected]I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?[email protected]>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?[email protected]0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``[email protected][email protected][email protected][email protected]0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=[email protected]#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#[email protected]W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#[email protected]V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#[email protected]V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"[email protected]U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hS[email protected]BS>ES=IT[email protected]tKQuS_qZmmcyhlcu_~\[[\\]^__Ėcǖfɕh˔kΔkΔkΔkΔkΔkΔkΔkΔkΔ !~2+[email protected]tKQuS_qZmmcyhlcu_~\[[\\]^__Ėcǖfɕh˔kΔkΔkΔkΔkΔkΔkΔkΔkΔ !~2+[email protected]tKQuS_qZmmcyhlcu_~\[[\\]^__Ėcǖfɕh˔kΔkΔkΔkΔkΔkΔkΔkΔkΔ!~2+[email protected]vKQvR_sZlocxjldt`}]\\\]^^_`ėdƖfɖi˕lΕlϕlϕlϕlϕlϕlϕlϕlϕ!2*[email protected]@{JO|Q^yYkt`xoiird{`^^^_`aadĚgƚjəm̙nϙnϙnϙnϙnϙnϙnϙnϙnϙ!2*{@@INQ\Xjz_wugophyc```abcdhĞkƝnɜo̝q̝q̝q̝q̝q̝q̝q̝q̝q̝!2*[email protected]?HMP[Wi^vzetnmvgcabbcegkĠoǠqʟrʠsʡsʡsʡsʡsʡsʡsʡsʡsʡ!2*?=HKOYVg]tcylrtk}fccdefkoģrȢsȣuǤvǤvǤvǤvǤvǤvǤvǤvǤvǤ!2)?:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-[email protected]USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"[email protected]'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E[email protected]5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%[email protected]AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J[email protected]BE;IF8RG6]G4jF2zE0D/C.B-A-A-@-@-@-@-@-@ͣ|sjaX P%%I),C.1=359:75@92H9/Q:-[9*g9(v8%7#7#6"5"5"5"5"5"5"5Įxpf] UMF?!:$$5)'1/).5*+<+(C+%L+#U+ `+m*z*))))))))xlcZQ IB ;51-)" &( #-! 3!: B KU_j x y y y y y yxk_VME >61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<[email protected]1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6[email protected]E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L[email protected]+eI7_SCX]NShVQt[P\Q\R[T[T[U[U[V[W[W]Y`[a\b]b^c^c^c^c^c^cU MUbk"p*t5s>&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;C[email protected]@QA>]B[email protected]:?9>8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>[email protected]B|ABACAD@E@F@F?G?H>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6[email protected]mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1[email protected]^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>[email protected][email protected][email protected][email protected][email protected][email protected]MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>[email protected]F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;[email protected]PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A[email protected]9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-B[email protected]a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(54[email protected]0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;[email protected]WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3[email protected]jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5[email protected]^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7X[email protected]_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{[email protected][email protected]/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =4[email protected]8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@[email protected],>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 [email protected]aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[[email protected][{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn][email protected]]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;[email protected]`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)[email protected]_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:[email protected]CKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1[email protected]/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax[email protected]*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: [email protected]UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_[email protected]_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'[email protected]%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5[email protected].I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU[email protected] ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: [email protected]KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALA[email protected]L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: [email protected]PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?[email protected] oBkC$hB.dB5aA< ^@C \@I[email protected][email protected]V?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: [email protected] VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A[email protected][email protected]??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}B[email protected]p>k>f?[email protected]_B\B&YB.VA5[email protected]; [email protected] N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6[email protected]~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`[email protected]^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69[email protected]N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?[email protected][email protected]j?d>^=Z>U?[email protected]PAMB&JA-GA4[email protected]:[email protected] @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?[email protected]BA@A=A%;A,8A36A9[email protected]1AH0AP.AZ,Ae+Aq)A~'A[email protected][email protected]"?!> < ; :;=?w?[email protected][email protected]\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7[email protected]cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;19[email protected]81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?[email protected];B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?[email protected]]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*[email protected])1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>[email protected]!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>[email protected]cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3[email protected]tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6[email protected]DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?[email protected][email protected][email protected]>?[email protected]/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 [email protected]!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 37[email protected]2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5[email protected]UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+45[email protected]4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkih[email protected]=?6=[email protected]EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1[email protected]QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h[email protected]_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0[email protected]PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2[email protected]VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4[email protected]ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1[email protected]WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)[email protected]MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c[email protected][7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5[email protected]j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*Ӻ[email protected]ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3[email protected]x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-[email protected]UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNA[email protected][email protected]K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA[email protected]z?6>5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8[email protected]PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$[email protected]_J6[email protected]VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2[email protected]{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;Dw[email protected]H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4[email protected]`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0[email protected]\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DA[email protected][email protected]@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#[email protected])>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K[email protected]'YJ2UW;QbCOnGOzIOJOKOKOLOMPMPMQMRMQNTJUFWCXAX?X?X?X?X?X?HIVah#k+k4i>#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0[email protected]^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3[email protected]\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A[email protected]>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6[email protected]&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?W[email protected]lL'eV7_^D[gLYpQYzRYSYSYTZTZT[T[T[T[U]P_LaIaEaDaDaDaDaDDT b muy!{({1 z>tJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6c[email protected][[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;T[email protected]WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^[email protected]\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8[email protected]aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{[email protected]{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A[email protected]/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICD[email protected]R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[[email protected]ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A[email protected],?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 [email protected]wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^[email protected]EUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |[email protected]veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 [email protected]HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 [email protected]zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 [email protected]gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: [email protected]TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmA[email protected][email protected][email protected]:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 [email protected]jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ][email protected]YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ [email protected] ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:[email protected] }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< [email protected] h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 [email protected] aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: [email protected]SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17[email protected]t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-[email protected]^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b9[email protected]3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\[email protected]Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@mail protected]$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:[email protected]C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaF[email protected]P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:82888[email protected]48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@[email protected][email protected]#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7[email protected]cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5[email protected]uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJE[email protected]l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtF[email protected]^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98([email protected]&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E[email protected]-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5[email protected]gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGE[email protected]o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwE[email protected]b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{E[email protected]f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķ[email protected]#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* [email protected]^}t [email protected]}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$h'u|*y8Xg@f2 䮋oVle|Fa1b&Eă7N/I|t+Q;QI!1-o}q?8+_^o?Z!1-Kqyw'xd:;dU`^2 :P/d6w_?tg~neb3 d\3 |hWDnٳWM΄n1@1bZUV*-~k=ccϷG>_}/Sl6s|4׺#쇕Yw{|Ot_^>~wݻoHim'>{[꿭3gwR4Yh| ݿ߇ftƮr4ks(*b&tC d]0h.Jk=#)]|RD.^Fq^/[6arẈda,` -)0]|w4٢Yt" At]+evAʠ0 -B٠qpPI:t|$]qھ<{&9!Xv|qvxuuߣ^z_/(}>#_kq^5N;WwgW<Ϡ>kvR?{9_k>/o=tpSDfrq /2B ܲc]ڈTEQ: ƬTqW9>x.ul(܄Y(|`>pQ f-i:bD-Gl|Cxay%9^f9.N'X_[sWRsn6l]ѤݜogW6'NoNw_^&8imoӎ޼}qc~ =JIwWW_zg+/g'bSض̥9i kw]K`"$j(l2[email protected]4|3T:rfJ*'Q8pFP 9Hj&h.u֑gYThG/V%QhRj F˃_~ Ҳ=نc O~m? ~?Ggm#t5GK Z;D_&ړ>}o:Wז{?xAz1/~zOԯN[7濻.&w]K`.WIv|g8QNj4\.'Q8s^mG5Fpz.z?nqykiTn2X1>qI un<~nwV՜-ny/{˃q3ܽ-rT:V0.mn$ woW>8nOuO_>RYzq\['kS,zcn#yy^:B|}G>hd^%Y =쾶z|= [email protected]+'ug&@?}p@gh @6Cg]l:!Qg^3bx>=u_KjZ ^X1>qIY[};~_ikti^}ҝ}_N;W}s)%Nf9J[?<\'F?7w֯?uOg>-^RgJuoW>c/W;7}7 >O۽PzG+|돕?YyY?5q긩*bƮf,nSxo L/ lN .[6 wnu@e6FH+3l]xĪ9,Z0)5QPX1٢Ȳس uh嵿W>Ȯ{wwu7yt-4 ӤNFkn9^"H].wcr5/~gwS:`]쭥ѧ:pu϶i+ߕ]?ͽ4~xF G'گ'闔_[uvTt!hN2h wFO+\[pE u!.6zgOk584KQucU @-@P`,{GSs2,q-Oި#K)>7usI]yw ~;V%=SϹֲL'}_;y-s.>~'S?y~/ݣuDOx_7ks.UdN?9>[L9bpw+ǿ>|w{oKI}{uz@N l%\tF&h޻L%Њ[/._] At]T)vBm8 ]YɆjY+x.]ͥ  (0 MTT @;o<=g䩧 ;y6ݝw) uޑ,;u'g>\=Zy]WϹwO7chG==o8w<>~yݽaGΜ6ѳ6=}>uWg75yaw:)םI}wXu(>罪/yt-C,5q*8ɨ$1G]fN`U8 vBf8̬[|R#Djr]U,I}dV3]лbą8,FZ,EF5QhRj Fe[Y!`hSK_#hti2ǛB>wk'F>vzCaޭ1>}`ް>}xzzz'M3Z[NЂ[Ɖ-uG99* `z*>ѯ̶.&8K0 K7]xחN?gʆaf^z/#79&uda8-B@Z0 |rzy]|_tez}}XmFN1}?.+oSL-p^1 h {  շxvz9xz=NmMhޜu7~?YGw{\wO[ kGrPg-y9:"o:>K~-w#;_U}o?܍mo>imsϚؼ>ǯuG`V^xKy~ǧ0q 2"UwD' }-V%3KB393l+E(WWܲ199ֈ2 O]VԶ0RiV%Q8( f&=.}5Žj}8zL}ӯmlM-"'g5Ybp}_.N;%[WK>'L}s1{R=7ݷ..N-omG},@9j[;·`[weg뷥ncн}ߏtsIr; >W΂~8-q /Xq^&qTgmed4skg!ќ[email protected]%19>x&5D&q\%389sE1 ٣߿yqھ孅Fz\]=~MAͼ^auy){9z-!<=]ܽݼ=]ztl}_/~C |ﵽ}8KE3 闷w?^/Щ~:e8|_Uo $hОW @qPEz+Pd.+$]oSyu^n ߲5C AaC3 ӥL(+fQ%pa,`-h٢Ⱥؐc`_3qy}o^ۃEh|Cӫ c.n?S=;,uw罏3?_'WFF іj>Ir`{^g{~YϢ9~|菺~' ˾Խ7Ѩ7F[?>C"?-<C upW|ϟ[_AzR vIcW?5幕( thFL.|t}t}lzozGzԽr3 e(W0F6%L2 faAchEAcb BI٨1`(<{WuWt.ر҄n.j ]Md&q},Qt\ɥvksa^5|ʀ>L#TFrd&2+6]2>xi-@0 !l8 f[email protected]hl-xtdDm8.Jm!(lՋ.$Y@F]{` 8F/½/e,FX([90h@1Q [email protected]swk|iIG\.Dl5S~}8thv.ƭ{nu tjl(UUt1t.zheQKTBrga0B#9x.׌ a@bb!E,U&BRaD7G67xAwc÷y8|vW?Gz{'}_kF;"юW8eVG6=:dP, L#DBrI :(.U3[email protected]((F2 \j3}eP!` !+HN '%}5;|f=̆Nj޾}lJuѭ'xm#6m2:8Og.5cG}9:`6;GOukx:٬OlWKꮾ}IlmD `:qŵdt9pm.N9ztmnN/z@ ,ι˃ݝfXua呩EĂƺƈT 6B}ͱԃNoPgt]T)TjN*2 |lN,0WdJje_k2:B/lVbA{_SO*:q~s;z~nDiqڽ{: }x^/z #_=4zey'>9.1Cu>ޞF}{{=c瑾zLvavoc|y?=Ob<ήn>{ Gm>׺| `_}W'/+x43Kp=O+Ё۝X3KSjvBo!Sծ튑 fFPH2TKTVrd@WtJh/+1Vb%8 yTGyZZ=^;㑍s@0Mne'xpkIwZJ{>R-}J27eDvm|γj7[email protected]1 }UOvomӤxחiIL -.m4Xz{z}?ͽ66ǔm{юїc+B)9atY/EQb~__'xoxޫz޿$~x~uι]?_ ] J=F_{V7[email protected]z Ǘ3~]}Wg|[뗖_W+z[Auv|OK]ɾ=뜳~ǝOe>+|>kޯN>_>goS尡gozE^|tח96ZD{ǚW|?9/L}/ fQV%t\@Cޮrnf?)gwueb.pI#G·4e/ŲdBќdeh;lX =yCݸuoJw?O_<랾z<ԸO>뿣ڎx~GMu{?)KpWҽgQe4o6n Vg<ޠk~v^SM]u/?Gg>ڼ}cXaV~yjL]l~mWd&>͵N;7nh"z6"~ Iͻ v~SSϺ6'F ly:Atw/a6'F Ғ/z+{Za軵ת;s()HcGް`6}-JuOK̟:|_?BcAdFPO+lƨ&UFarW̃ I}iB-1aE1b (XR$E-)0RhXU?{{oڇ3|j L2E*Pƌ3WlU$ˮ*ř/@}dtRr5Eg'&2+2l2 [8{UmȰaX1h1 L( D [j0 XB.*k l2f*ʬNO P_Y5ʈ|Qe0*pcARj10,*D_wO;]z*泼wuӦϛ=;پLUay;?E@]uB՞^4fӋ(GPH06C̵ @(.\=tRHƀ\3FW5M+)(gΨTgU|8(a X-D)0 DYlH&Rj X'܊\]Wwb"5A̺.H8 X(m 4pE*' j.NlM#WxqSVq|K% g0!X,AQ MB(aD)0.$)0h[9eVκɪE879+H뫝hN j!S|5 2iduR2sQtv1UY,=(FB%Ku(I]Q L0 Z,(** MS91Zфb(@_dىWģ[email protected]v{'?S^Timx:Ӡ=NuOoK^Ŵ:4Gzߠ=$TQ%XV4L+U ŀ,rv=cC p>vN>yF%QQbJ4eK8+`^-CZ*^$wqG}Ez _}].^2 u|Յ Vf!X0 BEX1 MTTsQ0!8͈[5z~\k.m^>y}Ite:a',i\VV_Gm |S;\um HR$fH+d볞MKj~μ`0BƉ ] b꥜T02 nwCW?KL6>qrWZ̃ IT_kC眑ˆ[4ch 0EA>Yh>IQK/N.JH1^z[瑑su~ԏcw/W-OϹ )$}|oBz$ $^[P[.-B啋89P@JTz1MSJ",6z{dUeb̃ .Qdapө /%:9UK8%ֲ,Gʣ,Z0 BPB٠фr_O*|AdiiY,SlLte{zo^]V^M^qϓ_d&-^וx}'WY⶷FnNvoewe|^?Q%ڬ1_cb멤1lbˢ*&~ebS3*3 LjCTg(g틹a8Dєd}9#51Z F`)5QP}';5ulrti.S׽8m/?G/K<y~7]_:;?_wQ{5 Cz}ܛNJɠ*ۇ맥ھ^q\/YX5J#D",d8S L]6Ve}=?|yWz׶| Njs:ƲmٜC-UI`AP@EA BR%,$ b)0${b€bDaWݨf$,Y36xU8Wdvhᦌd958Wϭ)uu|U+H:UhWW=>MrA:z$Ѷm-WnnZ0!EVX1X1 1Z0cI& bVE @d8/px|Bǫ>i^fH1SJ^sկ^=/8|{--9/F.jf[email protected](R@J躣0.Gؔ6DY>I\> QQlLJ5euG9C06BΫbBZ-(h-EZ0h-)0 b"$ׄQyނz!91ukKs> ꤐ!9,Ʈ=TBrD5|3T}Ub˄BqX ]Te x&1jrd&C WVyvH3AAk&WZf%*V+U-aAPa F(1 @RaET e`ږ®]^!yq'Ruǵ F®%|4r˾$"pTL+C-ξj ĥaB59/6\!SV.*2 Tg]+d[+$Ն'5-%tꌳs\}2p֋F`(EaEhb(c&UI[WBl M2&Ѳ39@H\j *7bȉ4^ZrdF.sV,*2 8.ñuif8|VOx}8Y JZ̲MW**wFg7Jy!Hb URj,фhb-&]ήNZ.aF'0si] Th UU L*N#e"qcBK>䢓k]NkQPx*3 )DhΕUfڦ֎]|_뷗n suYFjJ]Qs^2d6G#7qSVhQ "фZ)4Q "фZ,a BD)4cܔ7F'9j}t5A6gp3 7]*U Ϣ% .^.D'-˟kOߔ@dG(K(efQX\Ya`#Adu,T3̹IA֯jZ0 +Ea`(0@ B0(PX&N LQ]?|]9[|V^ TB`jN*U /XD틡sӭoȼA u*2># /ER+WB-lD4e.eYֲ/2ֺSp5q+фQ kUaB٢- ,Z1 DC9Љ` G61|~Yļnx[AD[email protected] H wBxRF;˾?Fѣ)&X.Cy0e ©]OklR%]6ZJ]Qs\3 ͗Z^z#lG5qY- c!H,h-шPZ1 1Йƨ0MÄUN^zU)z~kkWgE0TQ!9x%XTfpz~%*t?;^>$3  \34Okl[%ֲfњYYYg_k3DylUTC I0EaBEVTE@APhFGg4.AX,19>4*,wpY"^,N FąEpŁxWfY$_*V[_ܴ]TpTgt]1s| aA_ugzB .%y3fW QI1^"D0 "EVVBшZ(1 @X1/i#oȾo^x5Fg0RjUd v7YAAf:**&Ѳ8bLWܲ8t& ,%2hTfEh!$]ظf5%Y=:.fWZJL(p)Ych(-AjL-E@E-u0Bx D:׺ UOЀ[&QFLTTHDrsJ G 4IG9atNr|P(*.*[]f9^Tf$,&T.꥗3ɢ8UnnHz sh;*@ETGnnQp=Cz@`{:qS@~[AhN:C\:MaЎ8뎂; q`;l=d?D׻;}Gv~|qo=ez@;#ƀ8 q1FA2xA#fmeu Rr(2B%,da$"Q],d~s64=ezC~CK8J|uA47;GY;VȲ9cEA"/?F Ǚf9Qe:UB~-.VQD$ͫ`LٜԡLȱF6ZR(?Ncb>UӦ!{9',YJ[4pk " GtjV@rNIvZ;ԓ!QpJʪ HG,ʪ "鳑u0F}UMt>jVQpϚu$%_LP_MθpJ5 r:~U`xԡݼM$%0KG}"B nɫ,Jͨk ҩtf`JGG& ZU%bnA"Ax;?QPjyPlJNJB^A.'AX-]|DM {4%z=\%!΀y65>Iun@`Ÿ@LR&A;b]5hъD`5pN5RItFSIjEZZ-y?F!*2AVyh>@>rȥ4 M@:`G)Yvu‰MIr TΣMA-%5M/T9G NHYɇlNJ9%zu$^%g^HɃV+U#qtrծgnzFz!zXMjFN.)TJK:2%vZ~&rJuG-?*!B à[email protected] ;Ita]q:[email protected]?:av&7dtRA))JAD:is=>L M'i+Ydi(1f"R i6dX)OmPljO &ؕQY"JIh*E4{"Z`ua/3 ԣ6JAeJlH@ 6 D!o@䂔|It܎ښ1 J62Edeà;ItsTU rF56_Ŀʱ2JALl_ZCGUAWM:@:GݺDt9Ъ5u,Rrrkt#Xlj^d&Gs*e&NU~$j*"7FFv-IP TѩP`4yښb+UЕ H'05LH;&+ROIF4"e/[email protected]l5BDjO$FUENT7MS&}U \{5A*Y4_ET_H"e'>1R7I(6co@[email protected]<ҥ1VnG5ƽ $: K&#/ ڣI?Z5JMұ#gXIؖ0ԲN p^LN̦H2~RZKHN$=0ce)٥%@z)x# 2R B&@)K <^BƯ0S}d#&*4;9rQDo N>$M42u"i赢a MLwj7;m e&_[email protected]<}tv7bBmsr(YE.,|:inY?pj̥[O31+;Xh];deL2|EA:/n@@>~unnCߣR|R $&#]ZZ)(HUx'2팄<,VAwLd`Ȳo!1),鄢W<<3^RN\BnL'ӎdp$XJ̭ Ydeㆩȕ|DSvq=#2iTs*cj?ҬG R:C:t.MT'":{n7of@>t:I))kx9^=g @lP(3E"21WySdW)RT^I(13ڽG*k&B2|w?'؀~{t@w * U`f^ŨfJ<8oJah&șktUeȄkZ)Qź9a],kJ,=vL~Miu_I&[M m9" nY I@:C>T]kCzCqp\BݺGa4?]q u8ɩ\ 5JEcnr!nۆ:CAߠ>~z;ʨ%+ YhvD<3_;<'QB)Co 7, 1'&q;q?ẇEt\n۰jʩ6AWvmEʒI)X tؤ  nW iȷksH&m;܊8 .V,vAW+Vg-ir-G,޵CrCsw@:{}ÿdxݩ]|çvU4eK3<D2ȫrLbhŻBRXP"B?]=fٻt=eP.Wpę묱ђtX9|Bg/_*2<;h}I d+*3)];WpDtsWA ; VQD# ,Y9~$&R9LFpb;_ɿ:"~YpoP9+RJ>p"ynqkH.syrԣ/~Kwנkuߤ{{F:K5QmȩCĢǪ-H Xiw`BCCQ3V1H9#PǰP""C0bdAtfMNhHcV,(6~TR]DS3`*7nF,f,`Fb NG^{^]{CD4mz7k{gӬ4/)sjQIg/-'M#gQ/m;#㲂w ]s@? 99PO^?R&TO {C^^5ͯͯͮG\rNPDq>G_\|uRI*(<%K w&b 푫df5H&j5^zjJʹbFRC-x3qK fo[H7۟X@8 {\6{C\!T*i"!ιUHU vxo]"y.fKBJ"2U+XYFS ][email protected]dHkN#2t\$#Uz(y:^~aЀt?CɃ˓H& '>":I{o@<>B: \΀u y@} B:~ݮt>tθ׻CPwE W\}DGB` p#r<<àƄ?7G=|qD5Ba#ͮ5tv@<G`;z θayΓT{y\kq6r!w^&5Cn9;6y;!w5ț@)vWp=w7X!L>u t~[g}Kh1vSpnؿ{~$"p=" M?3t2;M˹=GB$GMhe{n*dM,~%dhcۃ-Uw2F"zM#+`̀M (_۔ SI78I`7CmA9d+Iv gPe[CTsQG1I?\RӇ "Ȼ*Ei^t.l@x Eސ]^.vH;rne4R&~7mm᳔3 64 %c =;DEM)(6pLL*":ۦj*voɦUPo|'G&t]94بUCE`訒|&Y"TT5"T}JMsNL <.#kؑ( ;)w#ۨ{}8ϲ2,kWv&`Y"7kmYi,Ed5:q $-wdݸntٻxS;M&J 6+ǰP ZD cZ#AMUA6* S] I5!̗C嘬tq eC}}{n)LqM _D p. m}FIBe:3{M*c{u)%D;tҚ<UP99OKpC;tbNEARntQ#A,4g J?ID_$zR+(GRUM܋ '# eB?|A (W.V 9"砚x]O_i_(~P܊MbзT_jIWԺ[email protected]9)M}@@m5 vSb"F1:?Mۥcv&)Pjŵ+Ub1Gj] WV='kI'l1^=VA,ջYArشh \jQn *q1h˴;:yB:$̤ LzъMtTk.XAԳF$m,{0IGkZԬE$~?+K-*5AahIFL(e!͖]JD0 ?Q b1sKDpz:8n=þGdS1 JɯM̫R =LLcw?MԂ5W@i7͓K;ÕIyE܋FUt *bIC~#z?ޤ?:NIWӌ~H>le_G:MIewK22۔ү_2&Y$fHE)GȘrdH iPEQ~*;E2PײkM+ jLȬ9G "dɜpA0r,cUf&1{#/QzbR}iP4Y?b80ޤh$x'ɭԇb] `'0ѥSIvuQ#F"4S&ҝIGfhlq[6bXm62DuT8~9܊zU1TPɁnG`~JRNc^ۇm&/m}$ҨjEܦOIrL=..A˩AIr˗O&Azó2i@\(eYt͙QOd'\(G3%㓑Ӧ,)Tog2klea,ˢ*YWD*G_|*߮ G3O$ͻʺGHr hA_R JswKԻm)SLb^ۇm& `U(]4C⤉AC; fda~Ήc׌lOXi~X`Rڑf&q)8")ĩbe4m[wgE3N 9 -ԫ6/ߩL $ēdb8Af1G6!LjU q@ a9ߨMzmLB^`(zPH ct])pRc"u43Ft+>TiGpJڀyUf #y&MIJp˓O8pm->0dWi,|i(fR$Q%\0삥DQDVNvEjl^}=DRyc< c_*ɡ[email protected].Ѭ4%G SX Qi=К*)PKGTh;ոv؊ &$ Bp:ې!RtH cv.:c{hCf)M3Qzq6ٻnŦTM6++63ԍ"P20ۆ~MߨݺD~9.f߀7"Q&F!7I{/Rtpe '*A&ъ$7ZWB^ !=Pr.{THHH}{4A:o֯7Ǹw ,tH&p٪G LJ;&W}&a'GK_Cm1/Ohk:Cfqy !NEɞ>$5nFnPxI6~B( >qQ  >, &tĻ+ l=T@9̡ ?P IRDEM"WK!U裠}|s(G*J25th額Wn^fSZ)thVZI7pfg+4[=$#)(eR:*UKH]tE hIT#ޙ-WhL ]8"ҙ D*1stmDC}'@wOrvE#6("ٺ(!VnMF&v)",<`dbjdɢݓ$诅걏<nL>MHjF$f[ni hlvcI$$ "5q4Iϛ*&,iK"QVjl#~8TR8@uVoo&HiN9XN)?36GhAk/ )A#QsVdёH#m-R|4`dd&3Mm{Cof,ͼ|dZL2Z(uzL/Ҟ״qP|4BQ/;K: *GT.`9 .BAE|JD(UTɕۢrRcII .N)=xzP+D13I(`t:w)CtK'$S&L+?h'Q%+,h"TRjT$9tI9$ʢL*"юiyI54. dVEk&pᲅ*I!+# H*$~%\(ITO6J3&#ɛPNH^':&xs};2IVn~a+&h٬{)C5DrƌhA VPYt<RT[ǶhT`5dݪUx'$e67]dq &T?h$wC\mZFG4rpbXɶE,e?Ewb &&*)¬E:vQJyB&3D$lf0xY&RdfũfM\$ E!pѱC"X%Yt:L.AhvN!hݓyA&dGQ<b'̵nMF̟ɿn`* @^Je+Cn2t@7Ӻ+*_>ܮxC ^1 r7i3z+DLg@1 b9r˩ .xܘ2$Y?@ʼtRE듼R])1 J=r].F/#?~M뤒 b]ˇ.$<̑:QU'd[0 NJ"R>*].P)jK 젛:2N5ZrB˿*3 *tK/nvJQ&,ܙꓚM]?YYyS3RC$$T1椎wO]#Ɨ0àAa } r4*$(-к>^B[email protected]Jhɝ>{OD@>b부x?C<&2@ЮLajИ$Oy?(h@ȜrHeJl Ls6ۤ~|o]_|фL=:Lbk1LAR :HxTE^>@vHcBhDGF>0TWL8s  bFS3h5:au&BNs(d[email protected]؊ڢ_h؎8ǵɜ?%=GDc!G{t!=G~d i *E)TPti5 e8h(PCEEC :ȡ׽#Q00ʐ cN* *b`}֧=8@7dlRSUQ2. Iw~rHhK(DE U #]v49̱#}9J?}Q*WI$+}}}uy:V ~GLT0DcہjʚJhdCwOM?#ZF2Zv@XUBg+ڕ̣B!ν\:BiVЪTàm"g(FP0U4P>H U[_y]}5:_q= r {QO_h a3b ă_ { {WB&C{K/p@<(3.)(sɕ NUj"u xUxY&(lcԔ`MC( "*-[~[ $'-h {uN^pD!0EARP  }Ph9(DW= eSH ; Mÿ@lm:x׻^%Z?a[)1,r. ?2LWRmӨM5RF)bV} ɱ4Ӕ]t5 {C^״5 p GMoïPu (V16Ȯ|aUbD;t'6~8!͚oWB/{r:A2G`ۦwaŻ+W+'Af"S~dsW&1"fZ:d$ZFe"&/WQ6/U*Δe a*>&X1X]>DQ( LeLmp0^BQ1vULH~ڳC1]- A!IqTL7YiR5:~[email protected] ʕ%GnAT_ :X pzzȻQ/* 8nM p cPb)`t@9. ?[F)?0d M?MoskDҊI"!9m~B!5]8D1 Dvn@"ܪ!DT&=w)AM \4(PCwЇN\ =ɣáa19T)bG9=tG"L}W]Jcc3( ^6BQ[email protected]ЇCx?$IE5E= ]Jm>)d#Ƅyd ~T9rb!D©GpL"BBv#/usC`45׷\"EIa.&+)a>װ^9V \HQQ*2fGp7'?kGn"M ``D(픚=J͡*e!tem$^];7Xun]NL>uLoVXuUW_u]}tKMmER\D();s: "v`"Q"1LCt"GpKۡS: @ aTuqB Ȧ1Ln]}B;NRk4"&)螈s&>ё0# }E)6(h\kt1kKm60)_>:nt0SHSwL2(pe!п ϡD{jDC9?*Zɏ %(UDt)h"U8@zh}:( >s|1Ѐ%_MK"e .dюsJ%*s{Ͽ!GE1?tOoR0N h"KBre}sA?*z?ѰP|A.ϯZ43@!M1P ;3^ԉXCk׻B< :MA&L 9Mn> (k9 CLbM84BFuq"7$u {z9&?q?vs(btr$:rhG{uP,&) %釷@#6k_tB4B c{aB)P<!}8|` On!a/L #:ïp#Gލ{u|0Xm3Q"hߕ.L""2a8GM79= [email protected][email protected]=B:r$cޚzYSP Lr D{G\p=p: -GET{@. }*_g{Q { }ㆌ9h]=onOoH{a]MP { .iM @QUV҉>0! : )$:BcmEމhnOnl#H '@BB* 6Lep h\,: Scc 2bdKV~P."a9ڒ1 Ah)Jc eCt$a 6׬Cj:ss4*mK$!qЈCr0Gp#oAQ>I0ߕȩ$?[email protected]sl(_hnҖ4=C<|=_PQQ0<'|":RS{TL&HU@GL$>}ADCs8]v8q<@Ǒ8CߢNpt 薪YHlAۇ> :;x6'<qGcAaø#;%pbCe luGn_&: >6b=:<lQ*A >0m;x.<㰏#Ǭty k))サ4̸llأܣ_Rېx4DSɹ:UӠv JAأ@xaw0]n#;G* 1YYXcLTjf^sztDQJgb%؃~ZE(w}ՇQǓlq8;}v8GEM⛢5)/%6Wk3SlCEq;`'iw[w/ AU6bw~w]4kYi 9%Q͞~P4zvOwI=Av{SsNﲛUvW~\+ swdȯr n4Rzҋf ÍX[e5Zqk玵?Go3E@LǺngͷn Zpx6QxIg5(bV׺[email protected];KF[}lIaLXKŗ}R]|MθU}uT_vBfutoHDbڹsuYwztˌɫd[email protected]Wwmw;%v_<4"b9 CKchnE[yŞH6n^+umd{}r@a]4ȴYyXًsq^r*W}xfԤ@jhqL:Ork-y:_[RsFPV9`>bwؽNT_;蝟oSl~a4]ZOCU7>jZc1H>hPz).T/KսGaoAnԽ/SValEomo٫Or9GqS%MVUtT\{+s-,=ƪ*2ڇ̃(*h>_v-ц׷N7YGp E@YƒN^cq=0☸$V{U6A9[email protected]t5P1)Wb] RZ'Aizۏ}X{l>oץ+̂58 Zcþqj/ 5,%aƸw-F+'Ӵ,Qq ) >1ro&͔1RV[gQd \Lݥi^9n,ղJZMz+1񒦒sul- p2ѬE+ GT6 q򨧜Rյɤ핱kk= aU6Pc͚V܂ΊUo}H#dG|yHT%u/FanN\?6/ըع[email protected] æȉs_IrZm'GnF9FJϴ>z;;TVQԬKc="UaIQNȜuU_k]%9|o]NAYAV0vZ[*^z`.];T_+7If.]P [ [+|#j bO)2jjC~aӦw: 'si&1FcqgI;UWוu=y#k^e2)IUPM*+s*uEg$ 9[email protected]HU+cy.a\TɬYLȖ̬ZmCVtCV?#FpŦ-A?͘I!Yp}@U, GDhJrrX#(RUޭV:Z6F~ wؿVҰ $E]8gΛ(;nNg*\Gpv-So~D*2MMb @lݷ76"\l./g5;Ÿ6S͏x`lmݵ6N.!ͩ fsnx䴔 M&tpVZ D2ˢ"GmGUe/eEYh Ɍ>5"Yb?vTn-X&el#Sk-#.Z TQc,8kK׵[ir7Mk9bVuǶF}ZȳuA[[} X7pnڸBi)x鱚g'QtLp)qOadQU :ex !>*̮=ݗOlNl=s;[^Y_&-e䝟2 BlREINY[y.E.-D0ǓNI SYUܼțHw2[ɪJ3:no(qVւDfQAB]+cȞ^ۺ5n֚\mail protected]Pl)d&Ml.pd,u;R|ɊJmail protected]͔I;x-N'MBPXǕ.iu)ejȜ̹ s;ڇ8!yc^#9;2j@_Z+oztQ%U !RU]5QK^@nUrփb}%_iKIb~_@x52X^R\5loa n4ydnߧvJ5?t"1,06-]XnGa.ב xa5Fd}q/0Jl[ oVc 0[3zrqmjr6TcnIҷ'Y(Yx΀n._ Ǿ][-:8wzb4%L=ђN<= CӷU9S$v锤l_"^?} YO9-4XtGlnnH,S:6))vUiپ52ddm7XH؟N'`ۉkF)n;x0ҲUZ'}b}Ola7}EH&Rsn]r[KSm3|~LJ] ɪWyQ"w,iW҈<ˤ3Fy%mg۳|h yM'^;5f>ijq-Wc+Roy%CzӶBD]wcf޹۲~GchmwiCfp]x?%ŧtѿcü%36IQ4*9X r0L"ȬR};E%탰w!ΙݦZ@v؟Ldsqg->h?Ӱ~`FhҙLHoxJ="üt[!kX #wv?lS9Yw7}ýg&?c~LdUZOxېɃrf㽲;i^ؼ{9Xi{ xQuv>O*i[_ VGǦ,en|:[:Jjx5QMT+tH3qU2t͋ۢ;Q3cGFHJa3]<$d 醺?m=;sVyM :sT5BN݋U%ڥ1W/sD/{a.eMQI/<)Vy5+h/ vSTu;XXL* "kbp;Q 8o%álnhLY#H~ʊR*t(?/#%ҭ'\[񧫺[-lyw-țWyhQ=I2\^qD2_,nCctM+Npʨyc_ڋNJIY%W_Ǹd iڈ KK5PXmU3b{t[HjGE]`<) Yl]e}O4N!9`#K)Q=#~@~l;ڸXʖ'wXܟ}mej_\zxck+ u]\_m?bݸq7|dz Msb/@(_X%5 w6e*xVn㡚X{k||zm%k4S7Xj-nǍsc|PުRW.[)ʜ6qǍjƵ)sSyȅrv?eY7e^HcaUbX5e+d"hWw֣ºOQ:VY |.(,e?^_r{5; C}umJaFOE\˽9bh+RW<|eIRl%U?Ʈfxf*OjxIVM0G8~hJA̪Q 6 9.mtxF_5^wwnm//ӱ;lS pQ_ShY'}w>le7?ӡhv7}{lq sDi+J&mň;Iߓ~KfȬXXn4-^1f~}kk y{I fs#* Ohsf>5/%۴{7ɥ+d⠤Z]/ޞd[email protected]`?/v/nm餘#RIZRD e7?Ӱs~aL-ɍJ*7[voǺ5ަ!e @6Gr;SϗHI3EĤ[i=6'Y~wO` lAN}?Np#áMER&Ej>=ZjP'Hr: q4t<4*0>=cFh;vQv7v8z=u:Ou[xg7V4\ !lh r;Zә@TrۣSC~VZ ASxҠ,} 𤃔`GS_C'"5A;;~]t=1yЀln5Ƹ`2 ) r$07e\%_斗(a)>YSyŇٮH]D:QDIZ9zVv]Fno[Pu= zv 754t։;]YD}>jڵV&~Nڱ.504U-BFդ+ c/UPXb%F/:Ʋ2#bkJa^KڊKX̆*.D!slkGw.'̂4eUCV"P45Ssҏcoene@t) ݑbޏ=eE6٦,d4jj@K-9Xģ S93MZu2/l92x9Zɲ(p6O("}Z'N/CO8pmrO㽥sWo6a2x}~Ѱ7 'K%/E`60>Rv.H^Ƽ17s2+%&2YdiJ_[wm}JRtkSu1fhK]eoOPtmn|tu X㝲66݀j՝.8HU@ټXnd!0-lWY ~1POg4%:gypZ8k3&>t' l.[79BeI\ơw[ksrQHۜeǪk(#h;^9m}ace1}6Nkndln049_T-"vr$`]4)^X QS- a|s4`4ԥ>:\pC:0G!LcmAjEw"{8.8R l([email protected]]b%Z')*3~S*e܅<ʪy1eiG9TTVlWյg'JD_+Ob͓Kfare&M6kS2B셷 %UHk}iɉzFlPTaY&,mA|ouY'Lk"d};ٓTQW,2L8+^R= HjQU|,nVe),TbGWջ2,e(br^9ʪŪNpv&2>|[email protected]\_EsO-`oѴlfXe4%ʢ30m^rjj޺+gQd[!VmrV5mm^scjTg*yT¡P0V!@6 Fh?ڝX"/Lꞵ9@:'w9 xc[cGpVMn>.N\{:1aW؟vFS,n{ZM9Rx̲55&;62,4jæ[+ie ~9!J?{amtM 5 @GζUuLí6SZq *ʒ{RaE9xY"ԍqFhYua4,͕1E#T?k9_Rkp~ֶ` df$#sR~&:^e~5-;RX99pJJوSVŜ/NQ,j\#8reh3y2Y5h-U%CQw/#~6֣ŭڬf;=f">6"cw_=wȶ:ڋ'{1] oeP4 ٔ,;'jbTr%ݵrmUI86 @4ESx۰<-?*-H7w r;8-34HY*HRԈMLR#@8[ۅ\ZzϐW=yMOjqS6wFB+l`ɾiNNzzGʖs$zz\H'kɣ5깖6b<$46# 2&{[gX\Kl\Ni"yIe's-Y:ȶ\ԓS/r"}!2R&QޛPu -Ul"7JU!dȫ[K 5/lҷ T?KN >[email protected]PwE ƗbO83ṃpCCװ5u5Cڵu9_Ed$sK~[Q'Ud\ɼ״!LsGU#?AAC A 5JC=PT3 T3Ql"`4 8 E<,TGu.~4S hVv7tPV#=Wπm$zlÈ+/<}Rn46^dWI84gTGAkuYN0o졧5#GN6ءPDQOF=PTP^DAJc((LjCCG 9 r7B]oir:K-mS/F>'EѴ[CYlV%޺5|䣊/@ #ӑrod"davYX; n3٩z6M#QA$)x 4IEGsgFI"UbGjZY{و02`qx p=:Y3ϰ GA4pD9 r8 \n (Aaޜ`фE%Nү')Sdhz7]MMh(rڒ\([email protected]6'ִQz'`@ءȏS$ V?80GLڹz#!iKNHͨ9 8c!1}%nnaz^fuQű*w?RSʾޣ`h[email protected]̙DoNDozTRUVċZ*vPbZ{mՔExjȍ{2Pyg_+{eh՝-Aq8Nד7rZe\k㦜TOV#8q@@U[&O6z[khr+y^=L) fn^>\ tko1/#ګ1v^O{yUM~v]ˍh܎qj,ŵ}߳ q5\k)IdJPsRQI,Rۺ1L}gPMuq*ā̼]{urg$vM\bE-_zdMԩQ6(p9C9^` ~>iU@ Cc`t;rJL76tD@5`ic-x)O?)޽|Ras%W_)%Ys2_*XoVȊn*,v䍫ʼ~=1R/&[ 41k+s~\kq9̭TzYYJ ,ݘ$[email protected]RUM*&8[email protected]7 [email protected]"AP)uEP9)O;lB8 98 A{` b8z(r: 8Bqc!0rc;\̞=䒩q"ˌlP sPq#+)xvۃ9Iii{ih쩱o}ܾ5a{!mL~/bINzzLlⓛ[͂+z>:dn. IEs0'(;Fc>GjƔƬ᭯UcqΚ1vlc~DVAҙq;s\'a#UH[email protected]=5 }!pVm#JvCr#5W[? pδ~f 1 pr:3 D9  Co7BRx3lÚKxDn$^<y r:/^=śif2"-EɌ<5Ke&;l2xKM|m)U6SM(m^ĩUf&Do؛Pqk22Ɇ+dbc,n%tRkyȋ%noYF[email protected]jM:>R^r* 6c]5}v)uoSm:?E/7 _F>w"lPw lP5(r: r: CO,s4tGi8ea}p&Cs1xtb^:LN5]}{^װ^װu { )?a6 %%f6#MGɰHBHn#.0q#QQµK@.vY š#EGQ\=$hF6MCL\zP_쫓FןșGk9y8h0p;8@@t!b%J!Ƹ!Q ]$[AAgP7(c'YOSModn=A:0p:v0r0rQH@CC 4 !8\Vajr'*[咊@4Y~1f54ƿf!c O&` EԆ==t`:ӏ iMG["mEh::N閏m@#YʦBiP6) Ocܑq p/fidLEhh4;tt/=f'O@t !:rp[dD3׺۰:F*.2|%oYo^kWRJ_+-4f" +1? ܚEv(ɨA:i1)Ǵ ۷QekRn6@r3x9йu)! b \=pSLQqU du ޏ_#HR2q#C8Ccc ^`w1x1y[email protected] !%)UZ)~UƬ[upw6/:.Jam d#O:PAk CyY[email protected]=Q7lڡHGH'ohEDJP/AKBRrњ5!v A a ]҇nvzlBUR+FbiUU]P 8 TUc!89vC^sъ!Ƹ@B]v:6B]iaԓ$){f@չ3|s!G_o^״ڧٶ#^;tGmDQ ރ *uOa^5pT+% j:v<ߍSQTfܤ][email protected]nRmBAzAv˰bMVGҎou.`*'KG]>P4[email protected]uLEH>#D8h4!hv߾^: PvC\n% 4Hb3؟SGtRlܥ=8MڮrP TTLϯGGR[email protected]: ^6@8$L]< U@{XU̍C9- C0FKp4!cc^: ^z9t:uqJVVu?ߠ)`v"P{G\ji=1V·ڜZ}S˩53=P"(-8[email protected]:k@46X=EfjR~Am2|cT #6VN -Te"k k/xnEs~R1΄ Ս1 lP;AQEKЇ80p:^F/G}:mPBHK59RK*q:8)^TLԅI(9[Pr@%(L3u{uPiFpQLb g#6.:b=PSgJD$(/:Rr,$ߜh* mDm5V:!?zÊNx)$z؅؁"#+)8ZCaC9n1x191817@BM5`xTF0>-]E?հF8hkhk|΁\|6秊r{LQt%XN:J^5LRQ ~G4IQ-+7-]TȓE/;,]ɼz)rsvڝ)y9lP؁hTT8FL80r1y s/!p=`w1y19@Cn: I~Ki۷O܉BQ1KrI[zC8rrMr5Ƹq5ƫuDt}e$٤(͔]v&ЗV JGЭ4YAov\{[email protected]r^GbL.( ҙ6/@99l?CKJ4br!˱CЀAn5A%j:Q W>C@2tc=l2EI*0tą@v0`f噤po5e?LA_՗@uDz޻~K5ajjGRrORs)yإ]G1[email protected]?EIh^ lb3H8@8 AG+*i#4C_hCc˰C9J!"֏#5ѤD-@ia%5rw!! ]:f3Odgƈb2QՔؽa(Z]e@PLq Z$Syrg!rHb!#):e堗 #rDj=sʽ 356hB4P؁ԙA 08"a@C5F/l!΄4 (@BQj>^F-#l<*ץ?:$ F8E CPlu6EKH?V.6H1M=aG >p(hJ6.]:tΤ,GE \:cIC/-Iλt"  SjadG I) Ρ&[email protected]^[email protected]99cIhv74;lZ+FR)TeV#o)JZc]S1qM+?EQu;pUjz2U@Z;qvu;J\F_/7#FP40+nu4ڴKop s`ZqiS3Q܆12bd8dw֖B׷ 6*kS2Y?/WrZ|tzxÙ'|,vv[^+3Ǖi\f+~*޻n3$e#>ȶXJn\z82Z*>rzZV֗v՗,1kEmsfu%ad^\,tdȯֲ]Xx Ɍ@Խ!!V w/G9湻Yn¸rZZ)1^bCŽ^W/>Ac8^!Ŏ$!.X|ђx챩﷓lļTs-.s+Gd/,W.Z2V [uHT~*frgFG/"uUR$]| H2Rijo^Fry Sfi,r.+voݓKh-ĻV~H݋V[O0?qߋ2WKV"ދ )˹MxZ>*0*.a,XzxJ^&p\+!qʱ93:?NwQP{l݃ctҷ^>WEA\wx|{t*xb).߉8\/<;j͟\`ڼ G3)0>ߎ6r1> 6}KsV^]wRmxFYEyc5k/uK;q7yb$$nGs6mAYLY~ػKalKP8sֲOΦ9_;Py~̛͜WxGFI-்? YY_bնH.&$εJfeKx`g1rK 1z:r ~ybl Er"nvW> QYuڣ&kv?"6-޾u==vFax|;+oJFf0J |lC5ȼu9BlE)h1/1XeC/CyRKwri#o_Eѳz2 x1A)ȏ$/H|r @2jJe/EŤ3qR~&)Rc"ĥ mYĶ7W5v ;u=jY'vqõxoƹEe;xy\K/hF=c*&3]ĻRc_XL~^<0vʫY?EdT!reWo. ZЙUر|O yy&|vݬŏ.;y<<׃2+rsdžЕ]継;`au_;2yGixk5:'r r]o!8}\[.O 㲴̬GۋWW5MX~#91ib݌.쿺8~Px|kٍG4Brx6G1mWSv= i oI8IGR._beul}{e/eG`~oWXPYr"DYv-WqZaé<ī5Pe V)qo+L2i-V͓ hEVY tiWF٨?Ťc#~uBIbv"ټ4?0 @_?s>R0\ (*}~[KJտ0;2[email protected]Դk\ƬNy^Z%lelg|@}{p*Z'y⍕|k77rM9Aԣz-{KNTe= ]-^:T9ԌMq{oΣȬ}l|d27Vַ?\}jۛO|7{cvGf.1^㡵˸mwJky=\~-Vжv:؋coէ:9g9TeU>\w2Xż(ƌd)_Tֺ0U^Ls ?ՍӽMdF]c# ky9귰qY^?2>]Lږ!TeicoI ƚڭQ3RV ƌ@𤬏* *^]G"#2.eߕSV.Ω!>mRPYCZd7et9_Zȯii5r/ٽYؾ^L v:V7~bƻ0?ȆI<;,:8͏c#mGTTEˬ?76^!!b 2mF]V<]Xr24a'p8leQ]\GW:L l #IR{;{|*j\kJXOGVH`[5f={o,#-֖qmؤVR!& 0#S.4-;7&c^cfO_̅\ʸoU$ǯ'KDw;t؏ 'Wyi{36G#|h+ە;i?/Y7H_#~C, y^GPC_!2M-A^/vwܫ_J30Qş<k\>D.uwL^My{j&*eWe-I߿)fO >@sg$e&. \` )&A#Iy ia]x< nxw{i1K!ޯ,!4^W|$Rޏ-ݻ)NAu͌sfq+..u-s2T&1^\9uuCn%A_l\E+q%|,I# K_fK![k?VC?Xٮ^K62WŶm>b: V?*i8;D Tgctg+~l b>ܞ0|lņ#$0ecJ> -Yx2f,%WyraL W.nڼ~2jTl,.חi[ww`+?tN<,O⾸?6"Xٴe!E!ᕹ+5(g ' OÅQ7S!|OyʐX%#|kTߒKww|-WO5ӐǞ$|'4t]+O~^ c\7V{*~YԞS6)g KyM[&F؈zz9&" H>1\ 3+U\b+LKo?v|c%ůn=]xu<%g.kOy(gzo0-^_ rak_bukm._5ŋkq;ƅ|7̃gʅ9X#P^uRiW=۩{m2Q^ݫwsBx Ɯwfm7!O^#;oEy‹9~G!,V7Sh3 ` 엮rR(8-GZ+H[yqe9S3s7[+6J8^[Uah{̼Y҇n57fpkqޠ:[Z&`CzO/\ø3r^}91Xuyoܗ jxe2~cN#~.%y z' 4F+SAs:1cv4M!algOc\|e~O1jC{pmv);xόiDybɏfH܏"a+{?Og>pׁOPzcji[v\E >6鏜? ΚHCq7^h 5jOk[email protected]zOoӳjɌ(T=7H>;j I/ƕC+PFO %#FcN4PIin4 q p|@)pPA̍\-H#]TӸ҄n Is*P 񺠥HXW~G3!5a]V0 n_(GpIe*N#е +BjqBhk]ªJTTZBl-i٨vF]\Ep&kWڈY㣬|J07dn@;}7ÿށ}c Iƞ^C#wJ:cNbUn Z{5ou\XȒnRH#*F7_zc̫^7HQupʍeT£' '悕V C(j]ZN;&ү/ {GIsY=;WWqb)k? ,H HԸ),2t*ƆRV#rUYv kE'tN),XHq[email protected]Tl.AR'iPӰm^!yT?ͱG~y&CrJJkhND$o [email protected](@%@#QxQjhbM1TZ)HqT#([p'(;ZGD#fՎ]kWj]G_7Sy|<<]R鮨z,&P.QN]yTBN3,zr]+ӈFRsE'`n]֣WLRwtZkH>bf:&Se?:H#nH 7ԃLxq6|`yryr;na6)Mt\Ig74ync+6F+ĭq_%M÷KecGFLV*F]t~SYy`Z VR<-m&@f8rkfSBhxv63<ʁ*@6ʢXI4*Bf *$; Eȸʖ[(`foBA .;@W7*y `Z"LY&FZD~&Hk72F*֐h˳);~E5wI[__g(.[J}u;~3?M2W.YX2D"D" *R 5>4]Bxt["QAw~uѱ28_9I< '$tPTbi`uԠFJ  TU^I|HHXXSuWԔUZQBhJd͑DMH2W"Hg ٛ2JaD^&DG!RՅ$#m, rFF&rJ[email protected] 'C;EpG$hR7p~v[M4::l9, RѼ;V[d _Ϣ^*|D!-+K;jݽj]W_ΤqgiBUcUV;{פF$"Iu.udvR4'].,ǦK!"DS(rWr& q\G+ײЮܞ:Ǜ#2~iHtF1c˽R*+ Vrkc$@$)aK* aXc"Q^dLܗ[<$,[]/W"t=%Veq"1EUfVf *Ū]:G9.»ⵈ㮢e2b ͕, cq#B:JI,ұ }R,cpZ#̖CA 9G P^YWUP.k IXC3diұ% !-Vj0,M<@? ?[email protected]*2YPseN$ \{[R U z̺ˍK2iTp ӆF ^fPʵbXȱ?-PT]N,̈9F2ex ½Pkjmu/$y뭏_gk}^~nkc\}mm#6D@T74$6\h쎲ZwvJx[ з $1)TXjʴN xEkˢ(k(<7A׎.2S9h5I$/cUFV  |E<(z`Ѓ 8`QB-OETfL(Uwp|l *[qnuL 7YSc$:`᜙-/H0VkD- VԢmR|#sSxg^*Gqb=GO7`F2v5)KIG`|Α%X4O]mܬhי@k|T/z rqv+xV879bcx%B9A܊&*ʥ)AJR Sjpǃ&<qK6&>*$$I U(x$ 9scddI*+bƄ^lbԡ БhڄjV4i)q kEu + >>."ʪC`n@G MA,7ѡ(Rcs9i}}Wak~>>4dvUs)#T""nRR ڼ`3 4 [wZ)Q$V$ررܑu`YD)b? 5>CtDk-nu4RbHwh`aC/@HZT@-N A< 3GmE8H oIJTJ=~f[1/˹jO%GA[p:}m,٦ux **v㮩 ϐ Ɩ6ȏH̕1xle; J]B$xr2Ƭ *ڠ+Uj cf~&p,c`6ioDhj,oRË%*naERKe xIGQϟLlfI(^r RW65Q]fɕ-@(+*;N:qFr#附_E jIL+t(JlIT dOi*T)!aYҭE[Z5ZXGseYFK[email protected], ǃHDaR+a.@Ѯf_DƸ?3x@HH8E ŘHC/C.`ċ[149&r0EepM=8'NTA2&cEBTRκYM:dˉVϴTx1 K**u֙i&ED¡T .S>dN d3*C9Tm"L仦K D"?@T*R0ky5G Vy!|[email protected]xdEMc.V*EJJ @"9QqP ω56_DRM* 2\nu tlя ]GcHDT6UT hFIEʫlSpw5#ȗ"ci% BM "1(7Rpu9buU3 Nk)3_ *d,‡!\–1q%.X([X1u%En8 ,bwb1o^cYbUb3m|B*A;8/(X*Q2#q?A`U  ʲ J1KpO6D#>,͒~HbhEeroP cuN:tiV1@En xA pٿ2`82sU 4 ڕpu!B#sD-`CJN9OdAR/ 75I!JiC52py+!Y c(jM/"-j`,iS6Z&}[mí^w z yj5QkcXPڤӆ2E#TvPtEu&ˈ>4Uzpk⻼7 ,~>N5̈nqU[email protected] [zm~Q79G2[J]cA Ռɝ%BiTE7s5;[bi]` ltNb¥c)g^J&HbGWv,rxMð4nobW~ cdEHY1̔e b(jj{iZi&e+ȗ.qMlUؑtxGPe ܰnR<"#G.hd $;pYnEP؃Nh 5([EP(رZI{MZеܚlPPmµ\V2JSē'(b4M+)r 78QG$t7)؊Њ{A|@ϐc.n`I) 2ђu܆i"JHxRٞŔ0cIlALP@5LXUKI$J$vAPA|fi;HB^JG[?~lZSKqsGmfh 7M~a EnRd0ljg"IBK(SAMc͏ #1A,$p3/.`T֢$)S#L¬W 5Abr8(X wC*2K^PAtw mWr0ǡga X&x3wm+2$wrR1Dn'$GQF^ #Za2Ҭѭh(G.($P *Mq:|:O_M½"##Y_sbњV]Y HF4,6ƚE1<`4AHA, ծxm"wX[d:d%d" gj;F5yHQ_'*D"c87pBU[ 52g+$pd8TAzHPH4gc4s1E ȱ#fSMw7L1+W,^9apݟ+&)@^kڣJ&;OHMnVu<Z"c∡M:93SɈ2E4|Ǔw$D[HRbljFs/6b$cά@ Ԗ"`#Wܰ k'QN\bN PPR&)@0Jd/`Cߛv[̤G{ڴ9%WL")բWPQf,A]ܢs$1>(+rrPm0RI͊,KF,\+Ek jʌgt,C5\݈R@BI'R w.V y(nfxT=#>MV"_E߿E etB(z: Ph~IT^{Nr$rvAPIHܨ&q㾱+7*x"DvKV7PhQɿaV4gh)#%9moFhwbM;dPRYLhueR${P8M2:9F6Q4f&ɒW%܂ğRUʊ;k\qqg'1خō՘T3Rjw$)n*jNeM|WmQANאַȼ@/Rd܏,X/64)^YXчHU S t0АA '5vzkMχX`(yEZD X J6+MK2fFeH#sPYIRMdž5Z9jW@nĂ Oԑ ڌ )[Ʀ(_R (@$`hEWթɊ eH!ftt~_0 b@izde_P$ff UpﮞgeM*:G0F F#Pb 0VNN8EUxT:Ҁ#JYk6NqxL'Wb, 1,XpPɉɒR( -PMI޽}G>oתz%4}F(/cEfP-d,{р͍UIєEcR+o͹ :Yȏ,lcVGS`82%[email protected]-Գ933cK#!PVbIa0[Gy]u!juH|R QqlIr"6Z % »1>N-]2F[&GUޘ4lPZ1 TrJ8ѓ,B]2NPFL&hq"ʗ<C h5F/Q i U@%*Hj궰ƣab!+29l\ mT&"^l|Y $|j$KLʏ*ZS13 вP~4FQRJ)DQƆbm(X?LlM~CdV#[email protected]IoFh>&|Y.N$%m~hȷ}99f+}M>D䴨dnο̱mcir#ƉV٨,* N0,fI3!%&eVjG+_|mj:w,bdr"Eu`TѨEµނQ:'v-#aDUe* [UI7tȉR I(2,W/3n,RP3$ /RTʮhwTSop͞ a FKCTI[email protected]TЄ7&l:_(w21]ޖ0@aulq Ӑ@j܁Xiu;1A,ljY3٫g1/;DV=a eA j/{ICᥕr(4,vfI#raID!ުx og2j̤HIA^MnsqANPڅ8]@Mk?C.,LH`WnU;'#?&$hjJܹdeKrIHdxie” ~5"X Thʆ>4u#M @%'-2yF+ta_D j*mz7OIe0̲FI[(phGЧkgQ3fnfP]P[email protected]gd$mГ,^F$*!ڨ,ԜUN1a6baV4 WRqS~H|p ϋsScsE.ъ2$h%!XP- ZhA*RMK$WY8#6BG0 ҠP}10`ʑTuk3#*lDF/)BUbHSeRdy h  qI՟ٿG=ߎۭ=eGzT<|4z":XbJa`ʼnA/b V;]@.[email protected]X}2/&Lk!gRyj O^tKЭxҢH>̬xD2obmNzG(U682)SR6;P%4prɬA%/3Ġ)2*X ފVލ/6#6s/YEmA|?ELeXoWG0Rn|.bR8qxbxHakw*;0d:5E˽[T7|5S]FLN9M3+E*rR(Jq$ЍuQg/~NiK̶yWu5zmҥK``1 JZֻ1 W{(7:n~:[=7@;>lv ;;t n.C㺬 RYjwPH0HS'XnyV)V% h| 4r]e$4`Z9mCZq6 Ɩ "-̪\5F_,V H]w5 ,)[WdV6o塑m*]1 wE"ءtcI0%J\yBHU{pPlp2d XxU*Jj zaIL^:0>s_20n -.QRvVC,#~Zadw -~ex"y,8.BƗ2 feP]I3q,asQRC,tKgi WXQwNKXB#$!(襔 y8i+. g?鱮K)2:V\Y,iYo)+G Ku9ϐBzȩ̣~喲UÔ`"IђW e(u)$&P1#3C(E>9X(Z5X̪JBM\ 񤐟YUeFn &\+ve5hR9^6e!p•`rOhʠslCP|T5"H򪩍d0Pl_ ?edeN3Ѭb&I4h112&U9@)T/"iy*j)r&IcMҨ5PI?,}?|Xa[p2/wY]O/fpUUT*]/TGx6eZĭjb5 Oѧ92#ZB)ђH ]/!ghQiVRPF!jYs~\$CUeBP,YknaϏe Fĭc")"=9v4QPM85>Wҟgݭ23B\0э |Z뎾#e5(*([email protected]I k5kEiԊn\SFBݘ2*ѦYN‚@NҠls5! D @TTqT>^<7gF R)5ڟϏ͛ IEeQ -fbda$36 Qȓ3㼣 Q۸1wVŗ b)@ z OaoE\| Y"iIXya Ҧ5ȲHy`vYe[email protected]U z"c`Du5ɼ9ҖXT`%Isgcb[Y[g N[email protected]һY] NR9e&̴.:"Def{3,;`€԰ysNK$1&tDSuOw}u?N/X!P\M31ZIn-hCG%77X"|>SE:0շ >p#SCKΙꤑI%w@5vZ7gLeG: zڱ"Uk*ASHXIiZB_BTXbH61hu4lGC$)PB"YhXD82'S#&$MR1օRH8#$fTu 0UʑPTۊC͇|nSдsG%b Uq܁q"28eb7Ȧ3 4P-SQprU{{'WSZjeǍ0e;;OP)Y.)! XFeEdI#CBя9SRJF*EOX3͒eEpo 4\֖$%*"Fqy$QԻyĪ&% *<_ź#d&hɎy*B:%IUg*)@$\$VV5V=\i3-"΅]L R!u:0Rhb2He#Y؅Tm j)1Dy4CJ* ՊYegc6dER8KQ.uYHIbȬ4$$þ,FNĎ]C\]؅Q[tőRt7[TQaZP\Ҳ!j[|9jPu,y HJSส jMuQ$ $B%[E1]=Mt2vzJ 1(EdQX8@sT 77tAUH59N W ;NۍƖh E ; R PKZTPu1!] *BAвXd CHP3@Vt*R $k褣7V9T0PƲ*bjқI ÕʌC!pKT(]a|$ZASB+(U @S}~ת>C6o)Ǜ^wh2*1A <#y6&魙2/29eˌ!1G*z$@jH*h;%C?&# t{D,W92R9X- Bi'V|;#qB+*Pȡw y5C[email protected]Ҭ*9,yiR:ӞD|Q+O"n.Tqu£MF"6gK):64u]ʃhC#PXݒ;l]sڠu90I:SB̮žMMYz?LXd %&1V7@E*_! FYcU]aٝ#!2+̓-lZ|JM7EƁ鼱":V 3q!Mj 6Xi)!-U?$ K}u[$tԎ'%iWBI%mhudŁ'LxL"Z[(T?I>W>TU3 ;K[-u k7$dE>yH%䪥$*5+I4ch| d]X7w=#_m(}ksKq̋^l"+OKcq F.I,^-&,2 [email protected]%WI/Qs[email protected](kAfWDV&k̍  ⵮1!yt`vKId nda];gC:)1&ۮ3&H Ƞdd[-jv5"%d CP~`h~ݡJД AGBn~u&6>t2d"(rr;FQh9#fK{ v#&9`5#SM 6;48F &UdFebXJ{驺N\wÏI١UVCVH՘ygw79#b`@*[U Nm>y6rֱS 7 v.1*I$jH wG\+7ȋF+p%H`Mxir0cZ20e4Щ#c ѫVv ;,qTPP66-WTgoimi }й٭ڪMXӂvC" eueIYPuQ‰"Y cȯ+G'ƋH阹rF!ǹMJ5h«RREFǞLYHm吏 #mkYHVIL[(+cZF"QI*032e6许OB"%1Q *qJ-hÿ]xE9yPC+j"35*(MF$2C"̴ [5pQ,DM*ۙh@[BXO"9PHq&856 VtΓ~X1к*ǚdjA+$wh=gToʽÆQ?ړuDTf>$MU6Rjk {uQjuSQПou;8ꝿ@ӰOYxKVc (+Kl+^QD m&r2Zլf*8 :+ AuRGsUHrrl4PIHڤ{uS 'HFw@0NCS~_C׋|:= q B`YKmdi[֚cgko H HI#Kŝ43:JPكꑹsP6SnB/e*kB*k[!_"(ܣ @[X5S:71'IԉʻokKVڋij'?kw;F{=TW>3BlZDo ךYE3U#7ږ x}b#T06[P iM߿|<;-m6ֻyMsI`J*j6߆|yHUYHe#PG>f\cDКO H}GqĆZc iu|$ӁC&3.+[ե5Tl3EPI4&pC ] N Њ+Ƃ[` ieHH>Gao&>D͐#& X@j]|8r%I1Bnj&_23:F[-A!EH&z{5,0Gx"g'LI1 ^X V/iRMv"kq%kB\8FL# Giو%!ewi3C>4RFy6Rʤ^5ZuRcʀʖ|ud%ұVuײry"Fe~Z JF\ ښnձa(_!&(Ⱥq$Ժq% y凣7Q`]$ VC$^rLbw :,E*.K9t 'ɉQPZ'Yee/X8eEysP4+$TZ"EX^8\$k~X R$aF Mz Lʫq&  ࢦl*uDBAtDk!!ԨMpb)>0s( c")ٝAWbMJkmMuz~7Q00-+$dWĂMuޭrF.2D ud㊚PEe0t^"E xǰI[>r\v ̼ؒ  +EdS!noڒmo (C̐g,sbfrѥ˖1qLrĂGŎw ĎGVv8Bn5d,z2Ŝh;ŏN1[nV *vP)Fm_Q.y:VPVwڒ("K,c{^iLY=N#4u 3HPH bI?'y#ȫ+De3(, ZRXǬ"7 *wlwF32^F5V-#;lօ:XW%hJpwABUCYeb=o/5YaB񮰙Sfϝ$N+:l$5R˩@?˕J6F`,[email protected]Wt2!XYrM4o[- խQJ]Ȗ< G^Q|L@ ]I$ҿHd%ŧ(y+ FI4"nWs&Wv<ѝZf;R*LW91y.S bG)-1!i̮Ӥb`Ȑ+2B]ylΊBQK2*HʐC.cĐJ*}~<5+>zY$ rbXp8wŏF T/yx87X',KT S~Im7oTu2"Y>0 5u,dB *ƁXhJ;K>gNYF` j`Hnt-ұBҌbK[QhU`0!|ȬME Kȅ,ր.cJS ԙ OM;Tӎy0gwVbQIfJbHݒwZ R|~INVHS\ PWP ةqb[[BGy\i`=)m~r0c UEh LI;FqJ; nգASREkʊ)jqQִ5AFVJƢVƒbSQjhø(;QFaAF5; 9 Ak1mŭ$VNdIEo}M aDbu(g7n55aL0bh4XT|,OG)4EֶM7HYHE^nz6j|GsSQF)HbBo}59"2h @5󋏏2j8pn)MMqCMIEj55z뙉1⒄U#E4jTUT C %.Z*] zi`F"J1PY %IRFƔ<ٰ |ĥR(\)C/%e=>K/c=.AZր嶆*6SHa)V ) 0[ /]mE, ֱwbW7Vv4B IWuPKƓ%#ZU66PSA8!!J@/ mM>>D &; e w =R'Je V [hBңjX:n:(ualh(-VS ڂˆEފhE(o:^2Z-jA sߧtU EqkE0فƣP1ƥP*iUSJ Ast%>xљwŁ#};9Xo+}۵i,JV0d+G4'Qf<,b;4f(+R)գ]xXI/)ƅ mwQ m[FGZH1EPEThvU^݀|hGR}`+4X % %O$Jbq1`KZE.$M*I$9x1Wb:!;E  uӤ O-QH*ГJf>Lq$(Lr2KVڂmk^C#c6s qܐb ^ Qj}M YZԍdtUZEE!z8 1H(B!KBl5l$F2YiV(:2eK H'] =Z|0嫺(Hy\j*: jn2K*|LA+Ea%YLj6Hp G.lLZXlfWE,HȎr%iuw## ۙVdE6(ijuFCJVEU+_MZOxDӦ?1D' eH*ȻCC$<l"I+FcDED7[X. O4LYVrF"+.m |J[aJYRIPeh3ljQ6r<4\3ra#9ގK[email protected]$YSu$0E0. ȎdxIm@td3`CFܴE,v6 l-"B2$:=mtޱԱ L5AD$kH0=SX]+#Lf -3Ոk V {XGI>4< 3GW{50:#y0e VP\sU;:fSl|v–V#rYhdVž[email protected]..f$H j3 +PH{nb|!69B7NyiV":2̥d6Y&LS+I4 ڏ sTF>>2WX}gg [&8VU5\I$Q>;+(%e$vIZV/a8&lHel;HifŘU@TIRRs7T* K9gpF$OB m=Aqi3i\nPhm.kMs WI._ ($%.HiMz >Ds$xDǏ[email protected]R8UMAuN R1CW2J= _ż3zl <$G0N/@J١68S?B^X+xX2] G,qUMKP8Ra,P!s9v[Ӓ\k}c=ay6FQ KՃ2Џ]v<dڈ9)!3ʹl#+ɉgO\" !F8 خ_]wr[email protected]K"mEE# /EhEVy?6Wx/xe 2W֤)ROE4ѶT!)} a+umښ7֦Ͼ,0o-.qw`EKb[email protected] .4 X"5"`€*6LkFb+nA*)9 x8ԳUՍoH즤ؼ -,yMJ[email protected]PM*k<&jI72[X}{r>M&1Q42-mWJ8J.hr3X/6SV1Z 1RjwbbGf: Tً6I݉<{h6^=N 0RiPKZ)@B|==-y%,S$ff@B<BIlwc+3 ~8<Fc$( W>5`Ʀ =JՍ̲p҂w"R_-xB:XZj Zhqf+ pD' ԝ :K$Hd4fP$HI* HNL]4 Z3R-, #pGoND7OHj‹(nA"SC4oJ[mZ]>8Iyc[email protected]H( ($V(#*Ɇ)tBdYlS'5 4Ji3*MjfXX1xR@IVSV7]WMHLD9咦˚[email protected]E(E hw$[YJ ZWF~IQ5T3P!jd|ܮ/.+bZ Ifܒw,Ol)9XBܥ7UI;ltox; *Hq+La x-!U N ZaZI ^[OК)Pk `ۂɿݦ;7-ĉVi [email protected] jF|kb*Mqz!F-cMw'mHb1D. x Gjk6+bęv>][<`A Jm̊V,2UH#FfB(oݚyÙIVP䍉#OqXs2JP~Y`iBP҂ vI ~8LJX.fj!nݜpDqܓ(,[Z2sA J>Evِg9\ՍIQB A>".$NX6妒nUpAeeaЫ jZ YDZ[JISi%VC)R9V $\bkujj,\3,T4eVy%w*R]ݝ0 Ĩ3#+fps [email protected]P|FAR^74(5DJnsF)b  4Qz$"E v"";FMUti|N.hX->#物̖(`{ .zwىynͺ]ZvRj\ey/,Kiu2^/kjNjO;LqAy #=nh,cMJ*:14*;X-Đ$M8B!l(hIƼNF$lY.-I;~uးOP$$ I{%sh补nڥ@EPX HksۏZ#n\{IWup_:i#:qXzխj ZxZ9"I/L#7ZrSS#zè pC5rǂMj L>ɞ<.rRi4 hAU'K,d=ݦB/(;I:yW4׋e5O-Wc5Ilu>m]%^:mT+t(j>[zJ:'#!c.Ȍ֎-h&iAn/Rb2KB-tqr8~c'*(2ʃ`i,2W~t'YqKL]R lK$UCk3ᡗ7HxcIK@ qQQ\LcƉ$Rōi.Bؐu7TX̠*أkBO M6QKg8֒Ddڢi>1+#]eqo Q:~,kyYYNrA"a`d% R?\c&B?OĘ[iCJZGh7(bH[`ntNuAϡGBO} R(r寄::v[j#o']Hނ_*'uJMEiZi1B2K͍ ;WZ5ڼ[YSUދHێH }ܝ#cvׇt=u\yx|G\u\F5k|'_ 03sGov܍pf: RL>wU# ~nДbg5 խ7rrC"G7LQ4i9]vHJ{U-s MZ8œX\^mfVR|Vkao"12J)5EO&\vh^{$KhjO, kegY 9hƈζșNcrUr1 ZFĈv Il@j"QA[y5&9U Z1%Bq ES/KذnTòoT꿫O7efo' qUh<+#'V4oM?ǺbEyU,wښһޅO,̷g"J,%:ZQ2c?Y37,uBCvRj ޗ0(Ȳӈ)2,v-~¥buz{' %XѓnZI~Ū+T lk[!W h2+&9*fSU$nVXCLHP^43HbDFe$lL~DXY#̊O ȡ˚*W' nJI$AJ aWҕK7N1!9b"+wT\YX&c$ȭad p&VRiia2I($xftFxJWÉ<=LsѤ(@Hg)E IlޛD/X2%ʯ{77a\MfE, 'Tq@#d*mֿ#Z+Q1/I%gl,+!*#deB\]MtLfƦD=_.|un06[zRˎ̅yIfnԃǶje:moy姛m:vy}_؟5ʪ.gv4TE1u&$%e1#-|o*ZcZo3a>VD(VJ #)Y$@$dRa߶@aq-~t}B;4u]S%B^` wGs9Tz[+u)Ѓ9[W\ܨႴQjx ]2 y*Xf>zu3%PY ` ( ]Y2`DGYV  4&k4gJF]Cqe^LyeyXc@wi"|YW(*咶ہ~њ~(Y@ĕ-KjP>OP4uPi$]ZRu<&u65v4>!5ҬahWl{ ̏ n`ܤTփ@͈ڭzZСBmRaß %nEu.UNڍa`& N# eR}MЉ62VD%Y ,VèrrzH[email protected];o:H0$ $1!HCBĂ/hfȚfȥ3U\w+m ϡȱ 4"Tji@8o-ksq 36&bLъ\+Z u rPnF1qf[wTPU"4Z!J.&U~IIbJc ִ3ccˬT20HT|Y:c>7 fWHVÉWhtVADfO0*Pſtf6w1cĕ_!pA.IȓŐQ!4r2 UkP jWoVT|y%dw d g"r+^:M,x$U*G*9U9aːsN5AH$,|w#1ȗ@(KOgGHJSwgZu9:2L2pd aP`P-QBԆw:L)[email protected]sO TnE7x RY`2ԙo(+j`Iȗ;,&nT"fIBdb ٣XІдt08KEtKHH\R򎖝'(ϑ&dj bYVPŁ)!Q̖#+e7, Z( 1!d&drPȖ,`ҕVZӀA=Es Q(ֲS# $:FD9g ! ʴZoXG+)hV" s2bdctنLYf+ŒDle I!J$G2t(Wtad|5#JmE5 zNJO#sɅ+rX2) v[uA[ TpG1xkjꇏv^#ZzJ:oo*Opx8>+(؍nukq:*5_FMIOAS8ƨ<Qڹ?{l6[email protected]UG_o׷[ *5T]st4 G=!SBkMitnkjkqq5iA =!MqK>ꇏN㭆:jPA:-Ѿgl][V5߈놸 p5k[ f Flv//BjT8=Zl5Sɹ{'w@v n\< ׈X7T;:~::[6vtE<:)(5֏?s[ͨ_}Q=-ux۠?|;T|>wTst:>e{uC?V+9jm=3ׯ6ߏS˹ƒ׭}E1\<4!ӿ^Ne}{<<5SA4FmZ>V][i'z Ǡ㪝ϡ5ۅGo߫zzkk鏳TluP}~~ɲ뎸p5>m;} Qs(ޚR 5>ߠo*6:j}~x)\5k}l=/<^~O[yu:5kruUZ*{ 05CӏDPU \0;vWЩ>oT5ׯmTuɲ[ muׯT; oR4٪z m)^)JK=ʤPV]nNzo<Pz>O~|ïW:zW?)e{}E,nwǦ㶶mH{y} ?çxT]4$ϠPx6x۷~'y-|oQEXxz:ff>qxz`'scHMj/_vqB#og\uyp&YN#U~âkj=qyT8<ҁTUr/w`j~g7[2\;P~^ >ozA#og'{bI;Ϩhr1S6Hꮺ MX1F,Cy␱SQ++^sbM"xLܚX<֭HQ;`eI+6Ggn$Zuk]/"F|+3 ړM+٨qp/vFf߽u$Nu7(7jݦ;'RȁWNHhP,G*[email protected] T5.,,a %\4eDfQAPH5e`Z5`f5ܐj~*X99:KgJYBXѪv5a6LpY5*m嚁BN8prr1Xrt}.Z*A=ǕwU%ANPmxS6L\QꊥZmؒ%#bFljRfʪڔ N_V h61cJ6 n)&8ќDF֕j"-J k:L^m޾}w2lܕHCMJ8ԘJ-8$`Mkw`2̭k]ƵZ)ϙCbJQhGFLӐ؆8$рj\xfP̞!A GhE2kZ]F$%m&7TSQM>^A*A(v*I(NnWRl'` {k_*3kiem;)5ʚi(, GhX7G=$OK$hwtz0lgf9V5x]PD1ʷEhqG/&IeU!ob5!n5@y2$ZTx'7 Pp+^hk)B<@TDŽ}JT0E~4X- Gy):8}gZ*w >l>G1x{ƨMGa#y#ٯXE5e>_"i'G!Sw~z#{1viwq ,ɑ'd "\ܡ(E85Һ>2fISf5 Ѐv`cĨ$9qd.8S(

^T{{}*q[email protected]׎5?UO[3)=}_W QY>c{#ȁ̆?VΪXXUԣnn&wQC=3([X joP8VK 8[email protected]ݏGY*:>hm]}T }{Wj??9V#ov^+R5ƣOO{ Iف m)逕xz臜|w]<[email protected](5\j)`v&4,4`Hƞ(mrbu>1cRƁ$7)>O'yr󡙌jEKOP /e%\xB,JYQE$$"b&[gI  b)PAVUtX-I[ +m㵴Բ&XBrTC*@Imus|qs QPm7-k^-19uIFxM1,S+d Q.1d A#BUҀj&K 0i.L|C paP5q96lQ:셨 ۰4#LjːkD`wUVҠ3̠&TԠRZu7SYDH%vEndž&ȲGB[#IX5 A]gd3|eYo5UzƼU TE&½2UWr8kQ㱘L`jz5y**(*.Ş8T4PMoFZ]i-Ă5̚ќ"TBZ^[b:'֓葩kӹI>Ewyկ[߼̆Txn~;WG0?щ$xY},}E9z%jC۸ƥl<8 3$ UƂ)ddfPVēUS[1q@սkN†JvuN.ʮXڧPAj)jaI<uőhm %̕!ſ ް[email protected] ==嘓Y- GuqP A44DsGO6vnk٨3&Ԍ1MlM$Ȇ9Nc+VVr u.<-yNXQێf$$X=(UՀ M8j8eJ1*MVhGu5bH5 Jװ>.Ie^Pq(6YPRTMEI,ibK5e.@v :=J*0 q9B>])Urj$pc0mx&%XBHj;SX^([email protected]b-Tֵk$ ^PQsHhEkqPwun q)Z|X .a2OwVI>d[*2/m,\ qvרdyBG"H3-v`wԍ dw벴$\P;ksg5XA$PxX坕0r  (]ɠ;gQ;J*+`.M,={^I@k BBJԆb'R{4Amw?;~Uڿ߰yqSJh[email protected]nwV#C8'An;DWߢw::>s{=WhRMdwOBQπ+"(kFAk8T]ƣ`z6jfUTS&v4 3fUK-Ȇ&֮XZ 7b\̥OЀcFwZiS 0H[email protected]#Pz=krĎ`SZKeWAYQgʛzU%CPMMS˗!.YDajZ MC(X+$$A̼ *\ @bcpvx 5*49&`n]eH4"|Z_1w'^_ ӸN~38½(17eiZ,nil|gkc%iwƬZa5s[U[XKVơH&塦S,RǑ_P!E> u]>8sG(n* ҚB32,L/V Ӹ*؂A .kOU~M8o*RCrP3,Ă)ZPk.cIP]A -5S4$[email protected] T&jG9061xupFhbҽ8\xK,JČHīBÈWؚ$ERCdƤ* \Җւi#(@$QS$@#ayL-,U-*R  * UA Ե6{ ޚ,$&Dt(E)BOʄsW=0@[ [mnx'&heh6*Es8V wbƢh /4FĢ1ĪlEZ3qiƒF&WVG musJ ~F- ofR#jhN31\U`]XA ıH KDQ!% - u6ЈrJ ʧIe~s5 ӹr8yjRꝪ)5O8>:^7USnUZZp߉b~I;N߯'맳Uv=b=[17ߟVެ?82* XIXww:?vb'o臝q 踭 :;+VLh$ȬleT +hPrA5&tLdoVE?DP iSusbBX*ƴlՈ d\~I-/7$ndI @e{m7)2 {tÑ 9]T4땉 y09m'{XX|;@Gej$h@IUP>,2/i^m"RTm$h9AkQnmqm1bjkNʌJoGGvjnWT+m}H&ey/ޤ2Ƌ<||PU 3#j >ZjXp11PѸdG+= >>.<\{ oEԟ)_O8}~{ 7!G8P}dFK;$U0Ը$$͓w$%ZJ8o/'sMOrD^SrMI:Vk\i-BVP_Cm,@ 1;k4Ҙ,F3 XnILYR#,HjRvQ]fd8n&-71mX3hU1vj2pH r.Pa21c l(oV%Kl lR\;#҂qMv=? +YT0Ga:<r#*)Amʦ@ PNʱQl3sCľ͘&c*F#YRR+䪫T4݉c&RB14R"pb1X8i1tSp,Vk~>JR:5XߴQzk]ts/J{s (Pm*ke]&/ T(P'LxnnC}\6$})3 0ďWKj8 v7'}ӹI>)*rgh\p8z-}? jdF;G=~9[Qc;Gxt3>;?~1>l_O@NwE=}oaC =)tJd]NMjne c:N3PLB0"d[ 7Rt,r)  \< =VJ;* ʀ+yQ%t!9Zr]"Њ Ը _'EzطmA4:wLrPԊvPPA<0YP 0[QPncqP͈3>#$L/ 7@*hVT8ʏ+;2FTT ,[#\0U[w;(nȥgYZ zG)&.Z"إ$xv ki]*|Z|;Rzl^h&wZy i& T)ODU߹{ZSqL.HJҶiZVh}1(Gq[email protected];W]:U/ n3WS~u2DeP%L,xw/R*"gs vVzWPb\ҁKE,֤ X19r*QůjT;/uoO'r{[oO3 Ql{Շiц7h>jo_4qUF@YAVCwz4YImQo{{V5~̬b, BCō[email protected]E#@)i޻b˂Gڅ եAPH"TqBdC[+—V_"(qQ $:>,il5naP7p!W +M4QUbŮR<(AGe+Q\lhA2Fk 19KP\TV؆;%&ɆpNhƄC*ETҕ:1 ńl9U6 rLȱ{Z#($oJjø&DT4kf$O UhcbYM q;:XnAU!;)":_Vpmnk,J`A޵zMdy7#|JV `$ 5 p'IˎAL'ʐ6cpC.D3rȘ T!SØ*Hη3+fus8_z6T]7:6 *АjGᮧdeZox5eC` .}4G3v1U*0$ծ٨jjH5QclQcKD #+!kmϰԖ'W -!48л<}KNA˔V?{?. c<{9 Nm*{WbNެ?=צnuPhuIT7z߸#P}މ/aU4Z 奤PNi5uV,wq !)J֮T]uoZR? %DH.@RI<Cגeu$+jMim*n, Y"+yB)Vܝˀ"X( VRW׬x J+z(VSi6f%9h*W`wACcH*3{ƔqJ};ASuY mail protected])f$e`u Z0YVfCByU-]$ @-⑙EḘF0{[ը uuPnE( @yP$7|:",H P77 Sq<ȨX } P>".ز6V`m mSJ٬YGIm1Y׍q#P+V$ׁ<7PR8xxE,T%w!Rt| P(qێ9e2+} R` cJ(Fiyo[YYM6 23-GhGn[E,4ֶױ5I5oVU-fHĄF UuĭBD4,2/B:VjF=|EvGLP67XQX5!J [ցFצm#G*hqs@K ej0``wh)yVDU5ܫw7j)C|2F¨2\wj9=%GYfҵ]9 !+Q%BP 2cP $FA^?IB.4dھ]=0nSА7SђvzD=~?/-VV>k+,I>Xf~׸}lmo_TmN=tVCD.ҕo;qF?PplX7cru=q@N|oxB-+oSۇNdE ĩ(trHG7$>I*qCv*JRjx\ʌ?"Ypܤ+lhHN$ζ$f%ڋ@0-A[email protected]Q̒cOW,[email protected]inDb_n%7a\FDx#J I P 8Lr+}NiXF#+|55 lT )Dzkbș(+^pj٬EȆLY!ƶej7UF%a,b A+h-Fj chL/ Dy#W5R$>Qxa". QIێ90r*RHܬj4 #Lı5$I=qKKv?p?_G8WAX8z8sJWrOϦ^laL +Ğ7:Β\`*)d"Dbn;榱`l|fgkf_aFRK>:21I!37/;$miZbAbd=Bb 4Q&.Kr Fh%diMH[email protected] A᪵w+ۯrR'rVfOMvI& 5R:.&FeGԑ$6>" 6#]f|x?auĢ߆ځ'l$|W,CLSck,`H )۲_ U# ( XV+6f7cǩ#yr H']BicF{ľ AD2K"=>|Bp^Q uyl*IP]aF\f9pqqeܤ!o&7 Mbq&s+2s0].5$'7ecU+3]FȽmv ״{;>AIiݫAK7aб|w ٦cğ=ّaF,0@4nM `? C029 7a_fч_q| Eb5~WEXn=_͕@+F86pk? StG=l8@y( Wj\I ,jr &QϪFQWDO ߢ;#D;{CQlcOyQ;h>l[email protected]ϠA-,$dyIr$tAY D3"*9wPȐ,o*Lh-聁lEB$<^ >{0?"ڣP)Ph5ק"˟!?NEH#6AZrKRqE7Tm޵5uE~uvR~aɀS TqJxkp+ųWoǿn?<=u(|U5v;mݷR{G}}~e|ʎ:IC\~G٪AFؽi[z |S}-x ϰn~x@CLT@` nm۶)dM ǒ,x靂'Y# 04>Ȓ:C0bpT Ez kC^J]B)i^qxÕ]V 0!G wԒlbJ\@4*x ҼhicHZE&vP +C\i"c:'Pq8A[-?džV[email protected]:%gDt`J8&` @RbĖږK1%_Vºčjǎ͌H 7ޠke SJ[email protected]MMÎLwd7 s`[email protected]rЊT t;M21!`Ve!fiѐ@SbkvV<*>$n"KnZ7Uڝ?9\ 1FnH5_ct"l<*TQ[T7ec#E Xh ¨]EX4 OpOTW\Y6ÜHgH䘑 4 l6$PNt܌l[PRM `Jc`iFl v\w&5DaB H$NԊA&i)HJHhcoTǛ(?2%5o}зƏ+AESAپv'6e&A]B8R$ּ5px֢<;hNBcnci9C6QE SUۮnL$YwTu.LJT֪7[email protected]sߨ9r@B- [C{iǷNƢP.Sw㨝2j UMv۞[>c[m.ԦRnDg̟ .įgm2 mSq- P FkVRMpm9"bjm {Evt&LmAbAQkSe H' 5[jomfdH:F5Z(|5&:s,2ՖŒ-ڗ m\: h8 VPSVdgM"T3 v % fԱH CQphwtʸ0S^5Phk͏+$)*G$:c:֍{\+EI5鄙iqp[Nߎt.T3QEM}80<m5'+>ej; Ƈs^Ӿ'U-uԶ],05 x#qlIV.CZzqsfbTSSN}K#ddmcq.5 C`-.h76:BhTHbqw33s 3 аss2Xn!] 9vYK,Ҵ»ҺHhEJj4,Q ]n&Vt&ǝx 鲗:a…õwH!Nڭl*{w 8f?hi>L$Cf}~6qQ<tpZvޅdX!)jl ޔ4R:B҅DrX#VP0`Av45ӳ4"x Ћ;Ң tbrÑ%F6PE[email protected]1fHo/Ui$PLBiJ :X64;ձ0xv,F b\R Fg` uLUE GV%JBEZks0"{Y溕 DJ7);h >R,@]e*D#*XuiM(FmިµݫhqJ. ey1j(Eue1DѳΎ4EֆO *J5Eu28 pYZEv,I$kQ^[8F/IBՅAـɟ6?rIecЃV.ֻG(2rHB%n-rҞx=$rb %(JEjL:%\tj >' E~ug.Bz4>$ f)Xbc M#?YX90?*nuh<45mOdK4_ ϊJP!+2͂u*cVoܴS<8n(u>nN0DgP+2׆ƇqPzDCg1Rq(;-!E?Qmα a:U0WD/AF8R#V7JR9@Z( U1 /5VZLJ)P8hswYcbEե6|tb T(w$'$ Ğd\ jH0k4eĊr :H[email protected]SEEWb$U1!G⎕W/}5)oSեp\Dw}ȊƵC]GYBx!C7:hdt3\8#kne~:lEܸr(>%ZW`NէY3|@PK!Hڇ =zB $cEu'sZkAS$ڀ޵A< =ZJUv EX- MZrЩZn[) JmG*i.ý@`l?"EQFii9]^,]"2ºyFba&n{)M.KK ([email protected]Sb #P[:Pơo[NԥI#}"MX7P;4@T6FX+TkjOaC;liSmkl#p„`T  rĪ+q.6V:FT" JZ=mk3BHV𽖆64'P\ikqz lH\LZ#Gi5+˳A; IɭЈ톸.(pVh7?qWRƗ|^4Z̥[email protected]`xVXԒ WƁ )h5 *cP'Je3<.$O\FPPP|!BE-"B5TE[ *PI1cC,*PXNts,#' CxqoZXeƬ-QQ"1Ïꮤ|y-fFC5Va(^0?Qkw7xj~ֻXWNaen/~0QGWJ)]U㎼8 fb~p\Ev׉˟V R*V-U*7?f7=J7x{5rѓo/6>S4}߰k)Z`?6H?`tZ`W̸SbհR%TϼCW1$][=O>UIժLcc~ԕ=c~AFxWh0ø6myp{yNoa覎9Qꬦ:E.njmé`DʨlxI prA )Pj cWgm& WmKJu ܑ0fn WdT'p߂G fr8APqq,L2c_+mv&R,feE˂VRHYO  I-Z '(ƙ.Eт@4jx}Cd'Q|\Bw6hiC<5 0pTF6 )uOd` ?I;6Avpy ooVw5H>SĖt"S~%|I;>ko{>]JxDÏ}|Qc7b}>yG`oa:|Æ#j4 ޅ(YT  J oQYWvb &\SJ*UIjoP0iZv=hXL)}I;A~5ƈn9⍋(هj8ӁkdƷE8>#^Q(nju>*A`VLyPE(jAW, ]J4;g>ӢjAQj@izEd]+7*7ٷתx{x )_gOD>~{蘜0}ߑo?cn@O<۸ NW#]gz?-JxGakb߽v>zGRDcqpz{\__xxZ<=.o_D=pOU}*u?pBw`I6q'z\E;^; u4Z`y.cl}~Pw}0 *iSu6xyc$H6b$7RX{&Ucp ~1;k1")6zI [RqǏc^m8E';&gdEbV *A:! cnӶL8DK20mRp>zVե(]cJׁ!sLVFUJy @zYbŅ[email protected]Io˚סt"PmZ[ciU6P?Twv/h*|ѵس{~G:*Œ<ՠdK_]D UOm2? T2zP~PѬMFOFHz{2 }_MDҭ5E:ތ݃m8kd>n) ky_[_`:j;wo>>hnUEԥi]]Nں,Y'UeP-Â)#ն PSzvjsL?pjcSMuH4+ ZãoPHm}v:b>TPG9rP4J?2Z: NA[email protected] ֌hiC[email protected]%Sq+ՋZ)`I,էy\y[yHY1. T6e`ɐB ƅWަ2^’,b6wr{B/AiwmOፈiR{j8n ?=~j'4=zkVe@Һ¾~c} Zx5oy:=nAZW(IoX?_{寍Ft?|{孧Sd+N5ZzMb}5kpNg[DiuQ_[>c{ЫqH8R3V+? *~B7R'0We~f;ʌ_A0x%א{i$= `` ^޴YP*2x!7/6Z.U $Y1߹_SCFj):||iQPx$AH#'.Xh#+؋vP 5 CIaKU|+ߍĻ lu: 02A⡉XPzZedUXWI=nlj6'c*P;܏Y-8ځɽ 6$<5cL$HPlVkA54LvY]قBj7k3*,7RwƎ֗Yu[omi\pP9`kqؐAc%  *#wwvYE8_ፏuV}~dd/ ^>xHQ}׉PQOL;>߫m^xq#.}mg"I^"(?MkJq_T.1 VȥE -~,K7 fS$Oj=Ί>d |2^in h`5s1O`׹\E{Z1oJ'hr-Ԟ#j~*zbZЍby "%,#@ qF`w!w]u̜PPߵPh]P#rT'*Dr@IFR%(h֚8f^çk\ڐM8q&\KbXf JP҄74C!2ax՘Uj8oZp"):@'7df%lff UUCZ] \ly"`R(Ym_aZ;5}%dv!"5?Oȅ[email protected]&2%dEmړۿ)RĤTmZSdcB>Ny>)\F_wv:cvR@tʟ[>Î>OkjHO?>y{O(#.W=Q}J?h%> BD]ibIf='UC%Q)jZ.ӶL9W%!F kܤTCY+4O%Y$ xm(ga L2(/om#42,ojSї# dUW_VX<ҴU,i@ lG2G' Jnƒ~ee)qbMMCx ǝ!ѡHLXJ[RMʹI)\+VS̑qRU;M&<_;?yDkч<Vw)+B{+S7X̫lƦ3iS ZPkFB0Gs[ڢ`XT7 "-Knx!gf$ q+UNkb:**;/׮19c\P9 M]I` WiK#Q H )@‚[email protected]VNZ4RBx UЀM׮"ec"Tsr)!`BC{k. u\vIqJ̪FB@4_ƣ.>LX̯RO4H6Eq^aؘ2^G]yBQpbIb`I K"YE^[email protected]Z6|./ʬ,"s .M &]g“bN+(HcVYbمAcǏ12YVYAf$suP29iknA] 4B jȁL(Pm4Y n3E#\G!Y1HV*ZCAMu(av.ޭjԢ/vx,;}zgc: !w>aFC' v`|hY~EXQi?Q~'}~q#Sͭ(a>›VaE$Ye߫T =g~ݾUؓ_{9 pogEQ柡H8p]žu|%O{?#j7GWҀ8_vϟU;)~Z%N Sw?٪$weVB}|}~xTwo?V-DpK0?gc'JiN >E\Q=~?">_6i*}uX.: m'o}*tQT蛁:?f7t aޞm;y׎Kr >MOo>pS{G=Z߇ɐ?+} vo <a UP~'>uT?F<%uEg۠T5;5d (~}enO%Wc{q㯀:[u7oq[HGOq&*_wZQ#yv4aB}ޘC/_i;xChU8AjT.ڣIi^&4'_m4!^uhR>x_W\@ExVьqڽ`ٯ[߯߯߭oyzu_c=iSOխxtһm_ÎrTX)7.M=cPz ԿshLB}wEXPGt~~'>`2z}ߞZoPqN׶bշ-x/~Uf''>4io.x:`Ҁ>~.B]IEϗ(=*-Hn!(w?׫޿$ R}y.F-޿u'x{GroT<Ǽq;qXZpx$? ^ޞZGa}Zm_KO_o}Zx/:XkEϏ۪>Zy>'M?;ޭUw{}ߠ5ƽsoGy>cR|;W[3jp{e~Qox~d!~aFk{";G?`~/s}CX2wvaT"ATnt~?YmN~f2+_n(ISշQ{B?cĝ704=vZi-?Z}>5O`߰h;@*uYX pGS|,4IRA%O ~]_{G_:=ym)j>o@n{o5VS]]W/vLO_9ۿoo_:DP'y?cR|qhr{cO5{rZ+?Y_fR~CLzX\7vZ !U=BD5Ǩ2wL) :G\YuW׾fC{N6Z P?߷ƞžF쀪*^2Nv~ap<?=@*\TygB}~x;pH==Aίno_quOqGP괪 #=Fkqo*,-TtU'^ @}@u{H(_;jh?ƟvӅiEXV3~#נA꾑Wgoa 3Zݧ?AHO=^Y~ vI>rRfn${{Ovw]Ͽf og$|ib}dx~?ah<##\}](?wP׉{HNR?:kh>}uC!ow sROy7}*EP@T<[I(N~᾿hUwh5>jH*~/?ݥ+šX}LJg ppI܃[email protected]d?>]ѿUx{5{g;j% @mmꝺ3O^~r(W[)^k'!W^''_;$A"x۠A5ίh_⓸pg>2s?^}5S~zF')^k'^׊B~Z ORxP+nWVCwh2<{qԔ =~A%4=׷>`}1?A<=^߭O>EP߷Ao : p{>E +Zݧ?=ZiP)j=fοP'\(mq>We4 | ϯצcĚ 7S\MSvXDMҵ`![}}io>Ӱx[;^z-=?5݃CE|HkT6y'_?P>ӢI"6n;567qϯߪ2zΫJ; 15ȥT߷W){y>x+]x_IJCNv+AGUS|N:EQiPjA΢"iWo}ty› {)J7!h;țQ;?4Z7ǻM)a?{/~?|g?/?~xUaTd3,h 4Spqf>r=tC,ʸ]cS2qsDGG_ɀ&Euٍ8QU:1~a T H>( e1D>@}<1  WnXd=鏧?ۧWx{G}!_.?`?#//"?/nORq>QlTI5 uEY"\Y8U((;6}d6zt}“$lAJв^Iɦe>ϒH*T^!`9 ״m:FVF/,,2}D7/UaduNfȡX"^4b_7{/g/oWY˧ Up̪9#^O_wv{DG{? G=} ?W2u ky顸V%kLX',lɈ"V*s*FA7|G]IEU{*iv0RKBjߨ 8*0O*SHŒ]DG 7 dVDXC/ڙ-ө!/WrpԈzYF>&~{3`@QՊ~!wU8$ݺE2{Bpvi a}5YƟd\(bJqrx/,[email protected]{@'~G~oH__Cڽv"}!_;=ts ~@??~| G}OFz 3(A$ a̘]) <а^[~7,8(SMCf FP:9g/&^8L3*ڮ;'p f+|bV߾*ԪS(f~hpTS{GqQxq_d9ES/bb3Q;uGGP2߶DNr}ZwH[email protected];FQx ?wí*L?77qd%O EԔ?C# CuDUWw"ڽv"~]ޑ#'gwOߏFIJ]'BUL"TnwCS!{ [: >Ȣ!d7V0-#,w\8e)P맾ƜK8 >$>k >2jt0v1ꯂ P }sJ¯#u'A=QݢtTꪟ<*YNA1 "}$!WR,P"Y{tCKi7Iw1ım3.KggόAraPH)l IT T w2pzD??}!~]$CO>ڽv"_Gz9bH^?WwHg ljk%7dݦc80um<+J::DemWWj<Id[@#^]=z3B S:ĦxD*>&gn ejE;6S)>n=j:nqMv:+rA"(9 c"|.q}ٓ4Tr6l"YuTHs>)k8eNesO)_Ő=%9A!!~],?/Ww`}"v"hzC=އ?؟?g~|?HtXǵ]l#0)#pIWXT=^xo[DM(CvggrJ RjfMRѲ`[email protected]>q=Gȼ 7{{$9 b39L%9QS1Q =G0 NJE7 oydYOt8^bYCJb(LSJbz0!M/xCyhM"8ziP<3%uS ۀŔ =[email protected]աNez>Hޑ_]?G`}ޞ?} =?h?g?h~o+,UOIkai gF u*/SfIJXAY7rUtLbCǩ"b(=!/?싦re@:+b*b7PM;D"M%Чh"| *{bk,}yZ<1TS*f1$]3Ox__fOc4n/YD/A\*(BzFi$ĔdK2y,&?Q?ELsy?`!~M{~[email protected]ϭ'~l֊!9ώe6+2˵DkJ&a b7|oX3sް`%l}[VD1Rs5Mmd;U\!R2=y%5|]!2H,SQ2ђ{")K qv_,ZjmM*gn"SJXǕ'Ϗ0 ]&Nƶdݎ]$ ]=rn$\&E[2UU./!py(¾jѢXkkI;S4ʑ >CS4\GNU s9 5G 2 6vtʪ&T|]XܙڰηI H)Әܴh15j|XՊh L\"JU6TU,-jd]eiBFZ99r'_[email protected]kK&0?ȼ 7{ޑ#{|M:*& #qn0wvYY{]CwY`9u4pA"&Y1CP޽'NjEBW?m9pre5>S3 AwJ%Uj]{v7}QB>$y̰$񛺂?$/˿䏧O'?ɮDd[C4LfmG^sg J\iv&ff^9KgK9q=8tfê!'wrJ&i]9UEZYl(O5EB=T>:8!U3;SMox_HM+ fƒ)S v|j ~ M٢p(F ^=L8{R{tc\m\QQf0ײw?e2*HԷXXTCċutINS"i4~\V`2vB5[email protected]neͅNy R-:>*CRer 6{ `L9Ar&ն r/?#{Km9δų헄\f%dE 2mA;(~0춋Œ驗{M+cfc%,N)dUI!)*`2w#wme0%*]eo6q@GadˬrpnK(69R'XGq^bBXͷX5bk#<VU ;j;w\L@thռ| {Hr[;iD;m;δ2K" 9OƗχ5[䴿 o)ˬb8^!|63YDa2jzB%^1FJ8|NpgI&gZHԿհ;Jɑ[email protected]Zl{/BYXf"71=̳`T 1Zյ?Ue:J3r 8ƣ箷d;WwI0cm̝iB8fF#GK*7EL=Y:tW쐍jEo;`! yz~Kry76IIv P> aMA Wy)R7%9տ.C#џ5p.l51!cQBkap,$ wMN6ڨyt\G%]Vov<DY:ݏo^[3ҕ{2/MN[ :h\a".#!Mr)gZǃܾVj>g=Ɍ6a4/օ56:]_ld&K481G2jkh0;iᲕ(|cØOS.rB{7۶ DDH2+]5̝JFw;?KXko&磩{jVzX۩F5"#D97jFg+-m͒zk k[{drx-yƴ"s*|Ox﹥cG'_%q*$igT.ܡ*/ضdVrN*%հ5lgv)M5FA4k& (o"Y5>L)y_d\52a'a*IsMjV*MǓ_V^&Dۙmֻr>C;AX`xe✭KS9(P b[%vSW#Wr1Ȫ4buS^# EKl5q-<ͼTzo]].U2to sGQ<WcvbR7D,~н:)E"鮢"F24/d) rDTg E> "cDDo?D>Pw P1= Rw>GGm*1)NEfg}"=?hz׿OwvyP^O#DQMEYBI* i@C@DG&UQuEY*69:՞(ߠ8jV)!EtP{=4֍ˮlQ{Ma~/2c- ^{nĢ Ή*QrV[:- :˗ͥ["j6Vo^:&Fv6ş6r喱Xce%- Gm_+7_vZ*)X L:.NJ{CanMb3 QS k6i|5$%[email protected]ٸ]U;L# +R:mxMX8 +0y۳H[kȋ|S4|庈GH7xTlCvYj{o{ 1R}=öEPUTTs@G,k_v馱;~W5Vk?BJ9gY4z_#(gLwG_1l闋zjLЭeFPiD44OD/ryiě[-N %]צX*dDAL6g)&bAI@Z׽3) 3R?,߃gL9ɿ|tl[H$PʮOm4J.ӌN" U\ Ék|TU"X7d uȊœW* tfRNd%Z4f}y 5tH/FNMX-N+'O2$&/3c'P?0#B=:4pĹƺ/RQ݋i:J7XS!QͧNMw'^TI@8wHoOQ{;|FБ̿Z`l)ʀޘ~`L?hGHړhjXS۫sc׌<)K=[0Q2M0v' (C|c]JqiM!V.8zQ8ol#y ,7{ O(쨫>U`V%7J,6ZY 6M6\k'튷jUcھ.1n97"9'Tw ڱ=%+~P.BM 9[ 6 ^",k+Ćyc={ܔJM=t-Ch44DуrAd Bذ|R`W=v!浛7.1x4d쐗Vr8"[email protected]sG0uL;g8Hq-R ]}⚼wi93(Ţ@Qd'U9͆ N丽[email protected]]%PcG3(UI/gR IUT!v}Ǿ8_j #w3t6ȖFҿYr)^M̓gKM1I )D)uYë7,#.wY-; a<ІCւnvKG>&fɕ$YEmƨf}J@޻RLMDC f3jFO"E27hD9Kzsf*+Ie\|3{ $sɆM*#qE/ǦˠvA8A%؟8ض 1֮)zbՊ)W z zoNBy!fcs ՗nTG%[email protected]/ת}\eps8&T2߯<&vεU^]d9ʴun,ӜoST⟥72:k"|9բ,B>E)w=uN|# -:'1s>F7s^['Yqfhհ_9TbwO)&Uw#G.QC, U.t߉2wwf6J;^-]Uǝ*f=]|UnGrp+O;5NI:BmK ]aZA;h 9G&/v 7*N jui(:b8di$ty}vG$,%vr ;CFB"GFh_ _-* B|C EуXY'IYˤ!1Pd7֯/ P|ʐ-'N$d_\0PO=T 2:{^D<=JfƳ1ACF;] D[V<̝mƌj?3ImK*{|?0ȳu)w.Ӹ:%yEҊGZ"2[~RNMqm5)922] 6KޣW+>!ü[3U}PkY̰/A^18#Ut/>P4K: edQrµP6{;043W.PpșV*q*d1?Ynq UMvb,Fx7S3J90u!U(vڋbt% ɪܐZ:6[email protected]V8Y.˼%~T~ h"G!L :"]R]m9[%TH?p{yvH\Q: C$A-* YLͬ(@(,lN[Ӧv圽;JgzȬSKGMQv.c!oJpjpEUA0ޕCZ4S_qKY)|6͓YʫS)1PZiWb8 .b\G&(DZZiUJFXHG@Rkaԥ*Z)JQrJ1ûV9K9\xS38 DتOJURiHbx]40U*\w= h&C ck^[email protected]&|G0TT̴v)AZY?Q"±DGl V]g2lm³K&PNFIz1߹ F]~VgK@X`k%5ᤔc5T =EEyGW[email protected]Aǃg=Յ[\c0g /)d'9gM_%`hEuc bTp◩[email protected]J;fq=!_J!M-FO:It3%BVw(AXIŕ'+/ c=U9'޹ :T*Jh;U~ۣ-MT&Y3k`D&,QM($)n9E+c?8.-''QR~ki2mrB^]|HnL s ΧhƖm lf|3FjYQ(7I_7ƙLxfz0/>nM9-*yGhTEe'X8ѯV:w5^t~Bfۉ)5~mhG+i?8`8;*CuZƜVWJW5):^"#, cQTt(PL=P>x*K)lZ"yBk*Ic-]J\>[email protected]c%"|5U}UۭEVAU 7Okd|9Lv*0H#PYD_!Lb*."WHE4wQ͞·qn8g7(;P3D$ Q|'%n@-0 ҾU",ѵu?}VA3v]lAKG?Kio+y'_7cj 4)Zfn(6D'wcJ=YCGSWviGkxipi=J=!c\M"B(vgw 3􆚕C> PenV$5R'O"` slvj?ΞkdGk19_]L Ƀ *M!)0z-Wj}^Eu]cvWin H3XZV"qɻY;UR8}-J}˻K3KŤGDA-ic(\]K0MBn}Dd~ +:WTT(D;>@bB<7Fܨ 0CBR9Eu}b>lzJz;utnژ)n"D&! = -;Q/N)X-#HU]Ū$PJ`ۡ@~!7}20EX5h@Le;TH٢%CMJ$N,TS8 HȪj${QiZ0 &ؤb#$IɀX@;ԇA=bqt :C (*LQ+/Y:jQAЮQ!식'(,n[ R=p6~Q,_0 LbPz|ș97`;<uqߤ=#Hzr|nS^7|EŒixi+j\#fXUt*x L 3q#M.qN`c[%7Z-d9A]{fv-vIIs$Ug-\1 5sCpT"YmtkRn5{}lh׊$سO7,U}[.+;?&-TVujFRe "LYpF_#o" ntgv$*av!*ΊWgrtrG4y$Y`ƣx ]StÙId:7 蕪ö1^+!=f`ioiRw .P:lx$Nr|[email protected]HSF)^Gݡ&"^ɛ̕߄ynݲ58𼆉֍|Ug9ZǗyo-Lرm([J+"Ĺ?ʥm؎nyo$osqEVk߻)hNN6& AD.h,W7%VlԐ̜p3w,;v\8xwM x~LWNN|IrhmnN[email protected]T&њƶ#+&UZNKVDZxbD`UwÅ˼+wK>Ȥ4E![kPb%GÙn17VMKd~GGDhzUuX?| i^ 3_lԉc 1˔ zi]9>{`X7jl 󣇙ok̯oY枩mfI([bl o>W>]x%j*SPt;rh 㻍Jt9f ӠY lM,u6T|dERbu8LC] WriM,Ӻ]M&h d{cȶT+EA Y' )#!lK b^ FmUpk[email protected]uk,[o<ޕڱq%OEoVZycќzbO>5K\cmKt3N3]h9R^j8[&$\@ >3ZK3)M tˌ}h$ XD#bplUYE8+}yg| ~H55ɟŨQԣ-9صe )Nx*djZMp)FƤXYK4$DzMWAiuD?[>Rf –K*>9*W,0zAϺϣ s} R4cM ",\M?)͸+&vg&P,Ǒ\Zt<#KJ Eq$y|jqUݰ{麤\k`ec̈ Kl`x_ڗE9C4G/#e<<|\<3U`;]Lon>,jVVgo,V:{_ŭٳɽ&f*UT1r!܋`W3<^>3:\VrjɵjOe9Fi I ZA>Efo3"\JoV|@MOY6I[#e|gDzӮ$1t/u'\Q5L_XYwnYhLcDZ3Fڮ27nZC2|R%Ljy48SgQR]7'aǤ+lߣe5 řn渫`e`L {-ogĚy [\Jծo.a.e4zh($"[email protected]XIɾ~ʱ:WnT]Xw%xĎw2xo(th[email protected]FX&1)!6=^$:xOWqG;O1rGu.^0٢esˬ{Ģ{>߲u=Otn M47O5,\$p27C&\,$uiGD;j!J fX("k@@n6n{chԭ0ܒF·bInE){Tʓ(G<_ }ab2t譢0$b FB%C5Rn* .oG}Lqz"\G^+TjX)|g5bI~b 9dNi@ x`;MTJꛆR0%"E0 !?OE2D@tZ*D|+4 U#Y~TG Orv- [n}Qvb^"OӸzm{5b)X^=74(WY3_H7X,[email protected]n1%xEF f𹮅X .)-S9TLyI}Vcyѥ--Q;w/k/!% *dѫf g'vrxd9~N%,u^(G:җJݞbG/~}5\ЧY*vXnwq2y. ޠL휤g(,R0}V߬ZVԳWHYT MMIe^x(?tC:rfxGK{ӱPv4դJ~"QO隦˪Ä7Ku»I 龜sѹ[email protected]FRaۈh!L ;e927p=Wm*GU,б ڡS"f}G*0)6K2ݜh7=ב73{okdLdgS *L("er(cͫb)6"eI4ija6qz\Nx# \4׈`(Ħ@{mڜgWFe a,ie赡2JXuVaP}݄Yg}^YRMqB0}Wwj0yvtB/\fKK*I BSQBRalmiV,쒵i-鉴%Y(z H fTrdRPZɲqs[cbc]\ڍ(΢SI'RUT[ t)\뮨1V' 'ݺQZyMbuȬJj%ܢSI5 ǫ~oϾ 7hK(e/RgvXN) \3J~$cQ3=];FBb%@DE/{K:x>劾Q!UXcXt[Gdhݏ7(speo4 殺YXw`c&N;:MD8SƠ%s}VNJ]M| 9nGmv3VV#4HtM"YZa^.L91M3EUʪ9iy6 Vi%1_$Yڳ 6Cٳ1 z}h"%m̉5;;z^e"g D#Hdݰ9z0UVuzΦ3ʓBr ᯵tntA$A2Pu(F;:6;e wë[email protected]mw>u:>rnd0GP4-YfHsfvjESzUput?S5+&]pem'RXRp➲T7KlN5XƻxLFðLnt\M=ѫ+yΕRQ*CH quv|\J7IT,J~*ʁfݲBh.pԍ.rH8Up+Ikh1&"/h"M9Yhy5[JwjE3-x6ZmNZa']a&,= *gI.~Yx:ݮwpCMRrWVUF+֧q ̈́ 2\Ddw(5^^ ]4K3 .iEs"Go ڝsf\Q4z|fp[VYK@;ۈRp cvfu۠8YIf $#Q\}M`}p d ?U҄!˩ީ6<]Aolco!v0 ^%GKTxemAgp¯ 7?eP䄟.BU&܄ת*J$I Y5an 8j {Hu:&yQb MdolQS&nLG6A:wbK"3& ])Y0霦(06Ǧ_YYM4Uަ=dL!b0{R8&u[l^Jզ$sU \3*d'P)Tu2܁ɢHJQAXY0qT5hpa"_*+" FtE4 ;JP=!_'_7~|y dAF8PMz+r}}QG7G gmQ a"(_0t>@}G}9 wƘt;^M5]4^e*le* -f:N?p&'GL 7}Z(h6+"5WQD̘OjVDYcW`Ij9dII2nUG=K(FfbJ@DM׻xn)ȷdAa>"<{T@= B{>.8սstHDPCiUz?nΈVXLb\8`xbKDU GzD~~OG]7JCIɑb6g[$tv LO@:v&/x#s,>Q=y{YE'kzR6~dbASfVcSs|znqƍfv^Y!l`t0Ʈ\KEC QNJLmR9wATs|H¾\ :*E42t\5 C_1Ƌ5]ŗ/u2m/7%]TGzܳ};,6ɔkc=q5{|>sW괼"W*$پ=j-XS :!t*M,hj0-_-enn:aqT,0 Wщ2MckPK۞0hyd ܧkGElQ@9h[`k^?Dvkgh-/妲ԡӪL,L-j JrA]nEn8^rL}U FF\VA'T ;%Ѡ@AhѤq~B;68KH%.~3^8j4_#47Rp )gui=Ze9#m76qm6oS[4R+ %~SBZj"ϥDʕFT= ެYˊRef䖕B|iulw:rҞqR?H5Ug-9_3۵7¾AfZdKrkQt\ε2Z4s0vDcA?Ɨ\4)j[s<&_|Ư]>E(v,²D[email protected]7;73O✰ܙ^_s>AMD}'SHXbav1+·2%F1xgv'Wm&`$",\D\QBqԵ̷A*k/Î5xm2ʪѪո{ ~HX%o35d\)cuFṜ$ \P0%V $.yLkG~#hf 5#Gd(?%آӜUtWS21B4mUJAAEt9t喿N>OgӧSLF)9#$ŭᠽFj*1W?~y?0tmlՍ3#oT݆6?']ݚUD}Y%.Ek> R$=f|ɩfϫCU`E6¼roC[V=^u}?FfBiF;k{11EX0|' Dߺ"DDąkuHM:׸Mx@ %: u(w(?x}H?ɸ7;Ꜹ̤P:PπLvlTb0ƵObܨa(uEfPaAb!c0 LCD! S@{~H}=?Xitez4{B ΌD\Hɬ.\ (xn Z-LL)Cv i&2,HBD=S@=Cg?؟}#HzG?ވTڰ|cre* (d7%k%lO*TJ`ux=Hk8kXorX Okа&ɢe+nY$/gSVY6ZIzyHX,N~fbYQђMeM59 FeћFM1F#BHm~H1E,D# 94Q3Ս°95*ԨKds:nTJNhy۸M}%ٟ!t+C ݬEi(Lo, #oɓŗpJ\Vdom@#/`fd}m"7h\E+)gn LMmEs u܄^BJR5PȋT=v#0gm۴dzAj)G*n S4ǵ*[+Bکz4VZ} ,ACRp"St;ڥ1ȳ}PJk5,9*hfJ4:gP}HTWAUʣoN02Z ;u'3 mpzmw=YIXtx"Qo$ATN|ޖr|;k:Nkye1Wב-5{Bb*H$38M}cwWSP[X;3 qu^Q/.];?yF")ENٹ JSc당$.W* 8~vΚ#Z|Ćoz۳htEwC4݃!Id<||bܨZ[v1ISStuXI7r Nq[(zk!jkQSk8"oC!`w buriW'Tќ~jz3I8與]2HIE?IXRٹ\:Tx*M1*Dޣx2;&-9luONZVYնx5]ԪSr:Q'DCYw.MNT*Ϸ&x:)Z6\'[&{]G9j,9o]?ʶpBq5+M<9xfq '\eOlҜ)hrbǪpJ ڢwtU2ee":eUqi^FrU7(;DFDH"axLR J?1w'|Tю[email protected]K,VHuo.H[email protected]uW*G2Cq܉ ׼ !. )A6I$Ѣ@F͓(wMCQ^D~el_@{?קd$,q蛡릡Dw!@{xDA܄LDXNRcJHṅSXs2pTY(70C"騙ʢj&a!9 C1CPʵLG7 (RydlNؑC8>@}=# vo=dj^8L+CۺyRB1zы>{/! ܻpn(n$A")Kؿm~oH~=dGA!G>;GR[_x%fi _"KUDpa3T''ͭG032 .-D'lVomLTٴCm!M״Qn3E-iyɪ`Tm$+Qb]NkFmٺ,-.cSY{haKq|0ӳ{=9qeYU#+%(Yc]&VgóIGf-W/wkc%,M\eg+^;Z>wS7pT)-fvUi.Vy,TSw'U4e(2X,܍ؤUWmt=:j7K:I]·|j4k U)rikQwAc.q'yÎ-3rwL_F}Wۗ6P''LY3IS$ҍefku=71Px_:iY{+^KDP˪񍞼5[email protected]*p[nA,7>fp"otZͿN'#5Iv#11 u2F%΁ /h*]pj\ꥉXW51)UCƜC>z }KSzn.uPy *@SlS@D(r*p&Vh3[Q˕L2^qK&#(e쪺}%'|rK7as :*倲qNB%ǎ9f\dxL73ϩp?FD1ze=*WgN(3W{kt}=WrCn*.{mY^q\fЙY;nGfuP={{)F3֫;IxV3H=G±L?۟k%N7Yʛy$K [,t(m:Kg^˹gwq3MMi~QipWN?B6Of"#"œ"'ľIaiNB͜PuSFӮ:sɽS*r 1 fd`a=km /cK Xku=2a=3%iƲv/|J»`W a+Yx:Wvih<}̭fgN;ewQJV:Sz$'$- < ힱrN/lU~IyN8#Q$+-A),.dv4ni (C->nw;-TڍVq>3*j.elp}6iU=zs#:n7BX#KhDhάCUُbЩHW"*4c[XUϿd%/I1=? fY{H 3S8W6JvhMGo ד6⥞)*]vW0%AqyP%mm1n9ql_8Yu&Ⱦ2%|ٳPgFq֭WlCi5%-Cs`R8*%n8^--0]K;gr/B6i<9񪅙ꛛ-]Vj$^D:UCoz \(LSYªP1Z]kN70QRqkHn8ƿ2̹K*z}vlz :\WD޲zX'1/H>}kŞ]Q|z^զ5;O}R`r/_ ݰ} ?iaIkgz4 ֝tC)iUUM6hfpY9bUW?p N_U[7#Jm](j9IɉK5?(xocчHwphy*JFbF朁%2:h,e=sx<[Wh59!4rnr 6WJs E%F. L=)mS [z9k}QJ \@ٞ qlu]Ȯ9KQzH`b N x⌐ ujq:c3Rn }nX:0CȱM%2xU]d}.p:б1f0wr!?Jjm٩%dz8tdۂ^Q)D{G ?"uO4E)R[email protected]LEߪ+fA$ǧ옰nTK[email protected]}c~Mixu"5& CIJ~Gww`1DJb(LSz0t@CQ< mJc(tE4:H;GY0/)[ w!Lb*uCƃnR 9GUdwNk5ru*cz|C?bVG a")`!0v^Mjh3oO%0H>ȹb?G}NWn:WGySSD(C0uHJEŽ޻W]u:RDL! RR@DzflCr1CHvc,Qjlt:puνT,H\zMb&aƸ !ܳc&p G~?N効10,Q-U5d1Wi b̏Wɬf$Qqn`b.q)1Zd6yZ 9l9pˬ^8=#^'9%tjNUS=B3SgTRUVflvg].qFguߥFnUj =5K~k,fk[email protected]r&Aٶ'u|;6!h[a Ay7+- roir1O_}kn[W5 [email protected]%ZZM>LFW+r4b}fSH&b.MR1~?V4je~? z2@3n$TW @9ԟڰ8nc|iuU$gqr" 2?.O]9C2 L2⾙2nk.{z%F?5ε45nR%c[Qh!L3]cvCi;AI~Ad$e)IEĕʭe$YT"@)C7Zղ,YxKie&dH80Ex)T +cحܮ{lҭګ޳4\çTVy$n%to57.74{,Ӳ-"3ZuoC:Z/HKdlOxc (yeͭ,ؾl-vUKg3rW,(8̘ I>lU 2C11>3R癮}JVkԣ 4Ԫdc4/%%_A҆rDv*'ڱQ[K0:3 gaʣnv*`fąY9v',:I%q.W}`NtmJYG? UeEQ b"x"Drzq'Lk?&T&Ty㼝mr#MdTc iIŔ53t5w/DnnەZa5mjAfP{HM{GטаohRWTbU8M=՚8^yFe,UM ja!#&&8,+Jrǻ٫yQڽ6nWߴ7kOZZl#ƿA#nPPm-̹gW9X3ZW{vyƴ)+n{4P* B OqnUV첰;+-x\6Qҙ>ÔB9&>{u\5DDN[}.K*d3M 6w1j9dEG o^gEJ xM2 lJJ?]m1 NUEjNSD:kJ[ɝJvTוFMm1SVWk Xa,x\.rbJa6Kد6ZkLdv/7E;i\#KY\BR,$[&^E+GCw zvԢ*T5Qj)șf2U%;]_0.jJo#>Odrv蘵RpVu͎Z bZ5t/&00h:%/YTdƕ`4#XmmH-ԜcJ|yi;KU>+laí;%v{MICʽAbbZ1@bH8#W+N,QT?I vpkv;Ǽ\бvl߳Me$իTLlح fR1F6KKqO,r#gh.᭻ͫJHzTJ+Z Nnj$TvƒWICjx=ٸ-Мʩ|yB]kI%6p__8v;L]2+y~>Iאڡu1BH6sfStt 0ҭ=3I Y̴̯vɽK-ƿgZJt[email protected]Ft%^= YǶ`XI2HVJ15TLt6~>YW]q pHLP0#a<7IY(X7fMPH eCwa+t8O4,03iLe#piWY$d$2=1hDXO/=Gؓ-5'C&/mgjss5RזTGwOT7Y[ӯB)@o S`nP9=DUE1Q''Coj`IikBd($D{((t[email protected]=!Wr:8/5&dyܘи]"L[>o\i[X)QxbAڤݠnb>R,SL+Vˋk^OZLmƅEHU%˝CCdJ/e*=ۙ5k1$uv tk GZPѼR#u})Mq\rwV:٘G]2;/EڧYB DB{0,jADlLlŏq{`d.1tm.>٤y9 s" vfեRB]°9M8ӤLec3o6Sґ[mUvùSiA4]EzELu[U۵^G0W&oKi+jΨa8B 2>V9g"' m[>\^QI(Mjk_Gur|g y8z9AMݲeK-*cd]D#4گVCMSӆndܬǩܺD6J̌ԛt;J.b$5ʹs]c?ʲMkhrTRiO$H2hzqsQm^$Y^3v_7˨.EzC+C6yCkY6K3&tz>gn;ag"t:Xn2MwY>Mqټt]",m%Vf&܋FGw|vtVg]yS0DV]D[ ׸okg'첿8+>rҥcSk}TvT+kuL1s@xӌkN蜐hrvZE&yH)Ot;Y2xTM[DRXxEȆmF[i$ %>q;S7] EJ/㻗 %oqF8Yj˥$_eN+D={9vUʗk^KK~/$$>ѹf-J=IBjg ]a$Ȕzv/GEĈuEQN?S}ݥf\8{$utU\zP)JiM[email protected]JqGd@)GƾOY@[.!BM"NӑrT""%:`"[email protected]}!2鐎YDcW{$j'%(T/yNABԱ1N=`s +r _t?=D~nf[$m%u]p_&m5>?Q47zS:p:,a:qc wotd\*D!J̏6IE>Mt"n㘞kQncI{gV_0j%:'9s|F1LcGWOGH|b;M~i?oIOb!ײW~gA{[Ëqwȼ:K26n'Sq=GBx[-Fcl[yM7 *Ecj|mƍJ#MuۦW&5vE6+6.\aS vяuRV/lXdcxEml^C *LK$ o5g}WSMIUMf1&x9Caz9|[eWi!;^lHInw^l|=J#3KU, ~uӱ_,ͯijjĥ]屬$*i"*Dc'V%۸~طvbwеBǨ?Ŏ "^VV}MxI0htR LW՛mjջ[تn(#:N'6-=sJh"%}4yFȲBj9($( bVz/:?ӽr/w:݊ܮ AR^^6Lzř >q2S|cFxbJSbRA!+TYD<< ҥwER,&'TgfwIOA{&4w"kk??߅kO/xص[v T̋|%ǐhh'#ݡ1v )~9;x LIC-xag!ޯ?xz\=K~˓+<^\oxx;ho>agrh8ƥMo&<صyn?,_0xf4??\b=olw߻h/ W ? ~34G%f{7=O;<~?)Ny)i(~i5,"CLAKlss]8Cd^ɢ޶d܉U(t!}GO{'y= ke?:C Mfo9UA'# ݮ;Y8{a/}{2DU)ESĹv$U>14ֿ Zd0q:QDܷ|^ ?cg3o-^+*hϪu6R"AÇ+:knl;4˒)[email protected][vHrX m#rR6xQ<akfoP}b p>``%\TJ9 NwO" b۫4NluUZ*}4$7xx< J`0vI'Jg"1bPM{p#t?_z/+Vǀujԛ!Өx6KЄ[Y=loKn2g/yUEB)"Ma.(S eq*ld2o脾Q ((dAb5T:jp !>GNϜEw dR^uh~CO4z\7d3P Q'APQSv;T@Ӡb٢ɨhH*M%&( Ŋo- 9ΫnM0 Xmd;Dc \r, ],`5)ʧtiP&Hw;/ZJG'7OTI(ϢM<[{Dݳb^Ӕiwk%Xi.9WdcB'= htH9b;%Xp<+!MuRJiJUF70P;xɔ,b3*-e*% 8F;F_O.Ufu$~8lHkL$O*܀ !_k3ؖ~ԸF5;f;kvj6H4$4{tHny?cTkd^5<7{Γ7ǹD)Q6fyx&622pWDk(t]vN=rA#ړsW.{L5;0lNkKOD]($Mgk!YĚ͔@.NBǟz˹˔vT7qNC4^*ƴ8!ԭ-*nbl=ݨWZN#he+uduYnUoW=pOjW4vHSn"k\1lNxEf$%ek8-hjĿlnobf/慘ere/O/P?tl2#ZyB&. VDFl6^64^ˋawY.xs~Hu2ثս2m-&Z0LN ֓p}ξT#kqؾVf}9p6=6Ӎ+r)`#:ht\ +S1iJCqg?iڦŽbJ;,D]E煎R ՕXEA6\:͡NgԶ`Ct hdz0`B-SBY+Ά5iUeb܃[dĸ9cjsyfkFrL;lUu(T< l@lv^M%X5V1 n.j$,uɔЀc;%b#C"_ų XQt_FkS@j2*^h̢X% TX:DU.Rst\QudƧZ&fvYqPr/*h78xx(|#y/aqɻΑ-:Nc-#U`2Olu<8lsUˉ6Z6]?AC3M4|0:3Vjl},B!" 2kgbyVӏU(yKbW8-&DZ];@StG.3PSFΫ4˭ZثV]2hZk]YV 덡.,1#Qq[.q)W)܍kIZ5F}(*dƔ8鴑V/ HWc᰷jӥqO)8sE3zy*ęZlS9 *fґ1ϛlj _ bc><7:j%VSa-Qa5S[qclbJ:n%w9̷+`w:՗.RJѱd"ՠ7#?!F6+M=ڔJ38)^q(2[YW k&laX$ oC-Q %]^9o<͉ HEqVK}ݳ ~ewdzɘJ)x1#Pg1(5J=w fnadZ2*T'ye} *qׄNHnUU|SxG)YOVzӹ-Uvο5Znw`YG+̷y"L=_W27;v:ãH涌F UcfY$E0r-USKG [[m٬z8\>&Z">0L&CP2"n`y9udRV cgW)$$)%[-\ DV[%Թaqf/rߐ>Er ҷjZiA0|dݳ]_ qbS/պ}{ 2ʬ;Z6a#1w$ bwó~_1Ygb2;ݞ5_CDLs[Dsf,*&hOi(bxm'[uumR)S!$k;(7^;IP!+qmz%6ELj:ai+ln!f+lQ9kuFL jcMelY>cIk0qWt[cm9ͤLFH^GHE) $ݲ6|JQ79ue'U6`_9$2ݲ%Qe$2!DA ^aourPxIH>AG6IuR oS>s(eĂ=z7("~~ɵv6ht;BA)Rb%PTS /`ldx&w\og ]fA"8t_1r!a)r! b}rGO$Bru#E2U(B=(yKݏ*[)AD*ܠpM7ꓦʔ@Jr_S `};!!nSF.%1:fabGF"Yq(@Mӻrt~0۸i'66BZ+kbNDqpc_\M!x uLfiE U_B^NZD 'iD:)D(=?#:-5"PK{ C;ïP_l//`/Zڝ:N(^'Wѵz,f4ѕlrҶ g"ev]5#Q),c.'_bث,--#D[RIImzd&ٸ3t su[o%h5JHGBJEۮ;ε,xxFh1!,Y *Yw}&7͂ %HͫFFQr JD31l[6*MU'Vh<7ibjuC:Ӫ2Qot&Q%tjtILj!IJT~wY}>U(Ɲ+ EhR@6PI1{<֦{Wt'?[up4:t]3%P+jΑ6o"s K9ȞP@R JYZ"UܤcD%^->jQPb%i<9}|I9=#Vs ~ K/Q߆gk+:MJE61v|𜋏nI|Ndޝaj%?+bYVF=kgys̍( qj+!7k;T0v]_Q4r-OįI}174#:ȸ'9TH+r;V9(QݯS-i}+^!:Gi+ R-z0beAGH@ ng%)f]3$nj>ukk̿F2Ǡal+8EIA޲zVz]r]&JL!K\s{]vE,$ٌRKE(q_51LnӎƦy)Lո߰n~ Q+PV9a1{DAA)V5հ  m"[rM3nlnc;TLFR-=Ae& aóFKMsGlD⪔MܮxD8޻,y@={SMEr"W9ոqm${HT |ʢ1Ź>'<͌%%xYv8hI4d{l:⤉DNYbORJm&$c- ª | ?׵Zy_Jb׫Y*5_ٯSH[&5e}DұO= <IU>0u:՝[ 2VIΩ#GWn6k>\q<6.[\plaT̽yo^ii*Oj=vճȴT@9ʟRkZ4n|rŴ(>4OVFS'$QE+Pv9^5RGO\sǖjt)*Kx쐫8MLL| K֧C3^bsϖxrf g3I>4T&(d=iDJrtfٷx.WYH{|oGfyS;I5ub7+ms}; l-Vj4q&N ѕVVx2 &Eűt $U1PI>fn4[7*1?YU'=>cB2 [email protected]UVEkSWtDG6nG$wKi[qsU{3q/{KH'F93]ۦNl+u\|F ͓[ Cg \gWYH䶝^D1Q@nzuVĞ8.P.>EiNF2- i*4jeBHum`+չdMDh& r83[email protected]"3Pd:Ʉɚ W% x6{%KͶB$|nA\XZ[DlytH=@*uKD'(Q] U+Vo9zT qtԧ)LKgiHt\'T'A0&ssX%5_{#ji:[._Pt=Hflp aj)*~]APz"cxfqyS?9:Ц똠;Gi<4z*P)0DsXD Ty(~N"#쌔ㆵCƓٓ%ݧzdZDVNLz[email protected]}b\w;hHLa_AS6OpCW2d RHղ`F_ndQ7Ni<}uE ?VœNbXnc"bVIJH$eG"($7UDH&F"Chm>N(6u1d[d" *K~@G(hx[?OïNk ')CG"Q'}_ ~>ߣg y8 ͋im4yy9h<}>loai{aH:^M pLf/f])W@=ɗ쌤d +:#?.x@ݭ>%[email protected]Eb;O78r{؄KƵdyvw-io+!cimrlcY9* 2Qs{~Ԧs}85=7#Ƣ_UkWUz}|L7Y: /Bh/9)5-STsx.%+/9!gkWa'd5N8XlxMq|%Lbr;qiMc*ܧiCjG|ڥ@X(8p7RdX+gEe2c0s_Q3smٶf"3 ]vYW唪9!H䮉zfYunIH{k+mF5{FDmX%kF:lR ӃF)7S{JPAgqm_?]K:|b_UPraś\Wn6 >gja& u6gͭ6.a Mi >2Lp"&1DX-z{>ue{}NƻV~8BbyVFtWe+MZG {tGN9lo?Sd?-wgb/=k3!~_{]YL d[+#*X"ڝ/oj1l Z{+.Ղq.' oj0"37>լ teˮF22^7lvvaCkhYU: _8NӖΫ^R^/~SS]l^k*.٩B1˹S7=U Um3\vն?Jme]bh£{dx4)Jdr 5:ʔ-Gh);t$=p>Sjdn#=8zZ[email protected]1t{[,-s;U4%hm.+*YD? mJ:B-b4P\IU.ql_T\5FQnC*v^;C+Ѫ1וA E;g28hkMgXРaԨFV*6kL*񆌢5|{7Eu薼;#NJM!uvTvvXgi5r*e#RBdV}z+)_:=w/ %-)N-&0LrrêRyvGQ~ >Cq#')rsJj[cfTG00EkuiM0j6Goγnsִ]DIBYATU!1 >J_21l]w4!d]#wP;azK$pM !`mK`V~ X]eʖ{-/ %A&k0GX9*V:Jd㾹\_r\b+~ 2JPP#Sl#NP5钃)Y#+.ˌiT'`ʵ[!t7DJ\/HvcdryJ=HDzmHTL _~zxeku+QhoA^{z[$D^HB)@"BD)p,` +ة,-|hg*U'r)J#?qE bnnF%w'-eOO2%AרwYc4HQUT0*i@"#[RddpQ/[email protected]˓Wxtu\TJ,cqZD|5cO}ob>Ep{GNz,]1+lo{mBBr:tpXy}݃ABj,,dbDf{*װ7kV{Pנ!(nfS WQg k6p [7dnAhP?(/gqZqw(fݔ3ٙ!oQjB!%"!P(~p܋ȹa\FhQ"w8^!ꮓߑz:$<` D.Hx\A˅ %ŝ+>h&4&W7tC9X.37c~ IVlȰԍcq[k+#19'lf@WE $HЄH_n7nK/C>M;z[Gg™"&(k]5G7 $#!{Ԡt2/h}&cbq|c6Go8/սo$m~&)]Xh tgDj&lG EiZ#)[eajf&2pJ[ygֳjO,"VVHIEEr1OTr|gMx\(Zw$lsadj։cUR4Pܚ~RiKtFZW)7&s\w ]f& f!ٷYRQ 2N;<^ٴٸ9|>83V,fF9J )$^UiRFfH2{8gt'hU暿-H4{c*oVˆ@ɢu,IZzJ4|ѹ$+Jn+U9U+k@\FXLms2S9Sn]lekq"YU(Lu3Yi+L(3\܍ye\Ghq"o8N!ꦕۑ9$<dn7e$. …q3T+|de<,7UtJAṚǩWig4fxؙ6OSDdZo$ ̖vzflY)N񢄼r>69_ 14LbˬKʶP&mjYpEvյyGbȅ`岼Bi= 'jS#,R8? r"wݴ"5|zÅ3]e=Ba>jxKdZċ-&hꥨ5 L d24[$AC~RY'c"I)x$*zeɱQfg~J9% #ePM"(sX7쎲W9 .eV.3L%? GXoNp]ũB &s/x`N^6łl8_cB%zLL&*7PV,Vew=*51#MBhm^H/a.(fqE¹q1}ƫu&|+Ry'+>Y*x3(?.lBR5#>&p]ҙS]Q4q/dc_6?ܳ -ZmތxiUl^<> >h7vh71]*J lBBr_TJ1tU%job#%VA8'3%*1ݦǂ!ZCm[7{(\\$fwg'XzܓڌBj&%~bcLqClvGuxklr6Oĵ,CFDZ&ɹ$$NP }bcx$*lbtY2! =<]岆MB!"Sz"ج*#^X+ҫdB>I잵PSpfITxS@J! Q="Q=]r.Y C~^(IEY֦ LQ:JD!JrbmqW /gfrD ^a¦X f˺qܞVB;VhY-j:$e UPL!7Q0FnpVUj MJq=V"UD0>ͦyF=A7*DFw3C=}kRmUjr%1$`w<~4DPP1s c1DDDG?\t@[N._P:u^ҭz{4 KS >_DzlT=e#؉;ހ?og=Qr.JvUh/=#H}?h?'n'cʯԩjҸ2A .] WN2ObA8}G-¨vUVy.Ѽ-抰,L{õY"vTҪX/ct^FYq'RU0HW7{MlU~=n6LZM} ?t+1^Oٿ<=⅊fkwDZd=1kQy"ٚ~w uwV;_0,E>ouwa3:=J=ԙ>uj,i irQ PD|¤0ۮ-Vss%5eq! E:O"ۍ)Qv[':m(:##mwlVZ:֠kDD, qr,ViY- Mr/[[)c!,O[9:dHOæ2zEZ+\c^UHiǍu<$- bѨ|ˤRAbUW(`8t[!Q넚+5i=ωYBMɣ>4.uzfbJ`UauIVFR~RycQ$8hh$>k+ ԕ3G(mv0 +d%*(DJ`e~x:jWr cRacxEdRfQ !$7fr_*:,[R[qUjUWDT&B&n&dV6; C˱w+p@5zvfMv@?/o¶8tKi=:^ r$UN]'n*69ʱ @}BsWyA*fQQ$5>.a W"DJUR9NQ0vڌVY٫؇i?]Lcw-MdU!NCJrrIHJHQ䄔vkUTQU&0Gg3歞b|]?\4d~JWW~QvOBtQuSvn+M2DQPD5]BKam##2 ܴ+/@{""?8D{~JKLP2g)CD7kZdN`Tp#(;P(W#"/ Ȍx~a,WO'? } z}>qpSmprҍU5_-dѮ,LgDev0$$mBeegsTllrH>AeC9gr E fN$FA6\BTӦݯ{o1-L B+Icʮ4Y`taR`j>AՒ_v؍SL"$)gT˖97#8)xgz6{? -zַX,P9x6yYp=GST7siUکfT\S7D=y !"ܶv%XAꦧE6 j_rTkwojA{y܏ҟHEQU'Ev̾ҵ SiBj'A-5R=^O4,H3,Z4+/tCқ_ƴmoh{ACe*Xy}{zgO`i4Ufsa]'2je0?x4Ze< rħfDծ9Y{ZšU:Y9x)SvTf M% )?!43i0_!;RٳMyNS>[LEh(;Z>9S-HB|A{bh|X{s-diV1 Jm SZG7f{*CWtY?59Oi%A]mvei}F;su'#ZHK#*xdخfޗ8Gm虞QPU56.ۗidkMEVz*qAiL,K˜FC;zw_ڲM[*rkpufRqcVK&ݟGH8 Ȯ]qrz}{kYdz|KtYċkn5t+ޮNI/xrRCF~ʇ֘/]ObSyKkŢu}VsdJnMIќ+9CBIy9hxvM+*2oYcn|ЧuzXx׏DRKRϩ/X9g:nTl48W#VK, UeQ36~n: VӏmM'"r/E9~.]}䦪CϞT[MxXv=7g<7l=, ֨":çZauFM(@(0D}oH ).PEAt$e*nT"JOWb`zt zt!>ϓeoөy"|;w_g?/_5h]9Tn *sxHi1Y.JHr{?jzLE:bCxz,9+G5׮gkvս0#7VuZ$$(uW"]غ#BEӳ&ժPM"!8@[email protected]0=F%8F{]6X:a=Gߩ'oH>}#4HMTUPPH&Dذ Tár(i6WHww~ϻ#^3VvR4*T3u25Tz&b?XpRo8# 8xeC"/:a׺Zn̨cQ4ӷ_81Adz`8>u SW `e8 zQ5K)T,ʧAY#&c,q(!"w[email protected]F\9TEd}1|Vв( q噸CWjSX/R!_1X#!sÿӧvLz)5'%:w W)>@}= _'~_W|O?ESUݟآqv6H9jK3dU7ѵiein,JݜR.pY!=9Xmz pL_}a榵Hm.U"6hfNpdpQo*O@BYNQtH S`B_?gnS\XL>F{\2iW Λ4Oc8bE=!:-T~WVjoE9fjih{Vtaf]aT >=a,\Ta H}]NPQƬ_-Fl6QʲbNe( R~4RWu1?NbWkO"uj]?Pzt)Q3&r"S0r:xɩSE$硌N\E6Tvt^Z]ӧn7wQ?8zON<5]MGBhU:׃S?mת#ІB.=al &n@PK;ǡeWS#~|_@驊96E)og{^?P@}v"#D~ň(I]X5'D:aWu#w{@@~>? ~ϑׯnh9g)tnGS{o,J̽U `no3qR,",dK ;d%+zZ,ܤ;F YG=MB|;u+\eB:`+ 5iSvmhUP4;~L16!9s_ca,Ю^j|N$)-4ϛyb (7dvyfK>!/.:1\,̳IhVTIdxۮ5yʲ;LsLuBbWZږy3Ma`Il{A^V(zSH~!cbڢɊ.euJlnB"I>Yc@TPiĪ3Qymnn/c7W-^:g@&R&q - aq7J 4zx.2MQٮ9y J(RXA 2LTHs[np܃@u')NSsQfdQHH f2"A a Y>v"+lO(w}'6{;st '1ep={>bvlUR]Lt![,3 vF'_ݜpo,s 9{w>_?ƉtOHt2 {'@D^c&Wd)O>}WUM'(C&7sR6QAJVlIR>ji)X$I!;|0OX28x_|ئdw20q@/S^4ئ ed!{$Sm ]CN_G:fԦNC[k^1w){Fg)Ϻe^MAᧂI5J&*ۻٖ7䬪R5sZ8~MH]YR`U7FtTR9Ğ -/ݲLA)$ŅywW !W !&P@{N.xZ&CK׭Y-9]"Vl[email protected]IpJM6Rꀘ6=>/I:c+[l-Z+^uhq8ݬޝD) 5cX,.U7&F>%—pLF9h`\U%|'LMqճvw)(#[!ݽjQ"u,k_v;ZȄs UhGQΙ mj( uC=R5*ZLض2Dۙ!Đ-h5:^W5\|aSSܫr:>@OaH~.^uhz5!lX γu?M>lK$} vKiCmؓ< .1i$%v5͂`pl>,T;5p)-[$uT1HS;ZYz涋osByd}]xdD| !M2K\%X2Y JXcePJ*edxT{MUt+'GeV)9YqX[v׫-MX989奁+5)!pmVr {>M^V֐WX6E\ hk,q|pQECziy/ߗm\S}:3l8 _fZAK/E@1@G{FOS1>Cv:̣Yot1IU/9 ęA#usS7jٕL#UQg*UZ5fWkw5cߕ<*y%}^-VESe=bZ>Jolsm[yȼrO72eH9}:ŲXKd=^1I5Ye{5zfMۿx,9}6kJuԝ>5f=jF.HVOM ]i-8ɪ\mrp:t}f]+O.P2E~I"ڱ|NQ2KCӝY-GZ4y*sT.RqX `+5g2 ;%^dɟM%LO\+o3J{39T!/oLF*v&n;oyK%tDp-$@G ) )5zMF!H!oh)HL$]eE"$]{x:/@ OV rЊMkqt8L@+]~?؟?!J#;v8=#DŲZQ-Fy@Y*_ߴ>QؖKC2~b䊧`|K泘T3&dԬ23ed,Yf-rxC$gktH\V˯9Uq<,m,:\ E4z\|;fl'QEzV㓘hFO&'ëju'K^!Hg5N4T걓NVI}*́n!q=+7fd6Z65W.28SB.HjZp+FL2;Bp[%ĊRy}yE̸1rjȉ- PKPiv)Ux"#*#TAO"2"Rpo,Vp/5{NzӓZY\b, /lK,*$xrbI\؁Ю0/Y&ܜMEI#lO~蛷#gj]񅍋D6KFUa_ OtsTJ#Ӳ)Tt}~0rkPmnLkW<ڥfUqtֱsi`^%cF0nbh_NIҥLˤNĶ`PMs cXvojV,"IxK)oVLtxE$2$2ґo_r\9LZRqiM5kE_u:3k8$yܠB9VI5MrRSw9vإ6%e63'.7I2̾nKdhw ֤g b%1-I_VU YӝSd 88 ejx^ AOOuVaDrԟ* Wį8䳮E|&4JΞ 9#sk]AX2|zyd~+޸[email protected]z!Ox߉T]M۔ԝddQVjD&M]ctFoi%"GTPP!26l\]oy} ƭUNlj0I\?NG}*+ D =Bq?.}tŶ%JoC14ExkQ Islݰ+bEK7]|tgqU+FR2Wcn"*hIF_1.lSs`()r8#sVäż8߰%=8d4'#rTPMWDEy0Ųe<Ƴ o#/FCu1ə*-n!pNŔ^9Bu2rpC3N)I' Q{P%cծ'isC`ZHCƉ4/\;q#ᵢm3-n V1m  {RNY1T"_$8xŬ:O^\J: mu")A\CrO5 8moy5Tfo1E{5( 3<ۤ&F*A,TUkAV/lˮ䙩4FMj4(NAaU}MfFmVjp5 gOub44 5\6:;@{=|M?a=D=|Ul8PPS+*yF#@1xV*] ~8LL:d-r2]VMģ=M,JPm۱sSݩU$vw9ܒú~f{VMܴNO-vn0 ;SgF;Ƣ.e,cmPyΫg+תcJ~9O[dgUeSdY4 vB"%g&U4JžhiVWnejՊ)9'fP ȜI#Zf`hNn`^]kPRߙz% >Uk*ĥfX_5}(){r|s~St-GybM0:m/K)YHr|isAf 9i)#7}qqv|!ǢrҬ6FEy. 2^ps1,sd|g?^0.(mٚ%V 9~3Tt.NHnH*tT3 +u>O+]oG&p~D-I1q;\J2ߢy[[email protected]7uN#*Ha1KY.vZ>ۆY\ח_n3kUÙ H\nib1kL6ڥuN#TZ*~]+>Ě=gHH5!"Q]}&Ǎ5tG^5v[Fu%n GsCi\B:NB*`eg`ݱΏM 3*PUfBUe&NǺfS1m3T3QcWFs52Dxs|rl ”W|3l"k\3Ulw?$җ!ddHnT+#S*v>igzW]SsዩXHw&:]%)(`5M^LzqN65b$,b*F+.t[$ BJPaT#Tӻk*,6IONF!:!E3TE5xP:,(SdMӇz%+N\EL>±a#AftWn3$*a)U3!Pcڄ -aelS3ކэVzҀvN=DGw( PfKE747%pIܑG(4ǹ@2(uP:&1s9DDDDD{?gz^T"1v1D[email protected]CcD3g&ua$/g,^"vٮW((ɪ1QH-}ΩI_ !@ >?vY5,@G(a `2Ÿ9z/!GOgG?OzD>@@NsPY'IkE:NaՆF>,'ެtx0 1ߧSy#Դ Bl: X bi?eN~(:+E3kյ۶:֖QĹbkþ|{ިܫһUA3N|宗_iZ>JB?ʙOU[T-k e_,7j&蚅s(c9&pZ5YnQ ɎAZ.x *bٴiEB  WIYWlOe ٢Eb3rm-rLyTkK}w*Y YEg)e# SUnzU_nlueХbmՉhzzVxD Rhb c~U9TBn7&J\t’u;[N3vQW`s(cMSE̶96>Zkm2B4J= -.؉ yJ:2}Pvt [H[tۥg4[4Xƚz%+*, Q|fuIx̓R%3<BM:jSx]7dkDnٙ. "HzJPc3ޮxz27XJsOTcp^Q&r pP]7ͦ]kP2jw kiihWYݫ4%F*w 804 {j֠g?1sZL&&eX9&GgYTuJۛ"ͫi=0XHZV-"7lG#9ç{I޻`xO)]U9P͔Q9ۘSN c Rcjϩg+3=HVPF\5bi&fd,E/-uJjV]ԕ:—QN=)6ZȺpnQʭ6LB8.RUcLņ\SA #y`R/⚮?gtl@2dRKؔLAwwԥ -AED4iV+V5ۙ5>k}aދzu[l̮uh;5I%$ f`"kHS9 v척k;m5V+Ec'+3ёSu]Apt?f=KPu )AO*R OcVnxpy)[WӤOد&3:0Qu?/^萦hMHejJZc9$ 1dI8iۊljS˸^<7X*]$yyà[email protected]bBE276K&H)iwSP[email protected]=r dz(zuU)@'P8dT!M.~&gYHd]yf64pe a)K͘2$BBAʞDl[_H۷'=fP@1 +שPpYLPP2Zi' Xz_?WoiOJE{$55a'D=fg0L=z>MxB QKU} {‹ӏw=}L:BS)JP1=No*"^$ʅȪD!}#.?a=4lKVsOl'NemWn"8)U1Qu6YdșQ8 LݗKl6_9F೺.Iu=Ǖ\|:JF!rpv`S8oۈ<˲N[crG6Ъ"MU75Zaܴ+kIh J2d$YvTy;;M/Z>.rsAPg.h1:_Q<{(Ě"u]v]Aahq#ᙝPSBOpm4okg6BR*$-daY۵j+%A hhYUJĢ")Rg7=;z+P\ft{gL3K7GUI oQ961Rya5eQ/V=3n>JCg9]Cm4N F4]Sw^7<yI'wJw`گ9jwM}TXrwU@2֊̇;Vm]nlv716g.[\oeDI6FH""DۆUOa [s-xU}C<{oj7:N/JB2EM"3Aj.\l䦳/%rz_^LI(]NJFmҍIӵȝ{Atk^][]v0N%w%] QG6cnm]~/q13^SfpD&W~ŏIʲ֎Q^Ls?-vȟ0!nfҬ$c9WȰ(Ϋat >fsGs㽁ҜHΡƼE(#?(-@6Ol1TP D.8f x#-Q5 "j7Y)e(] ,ȬXdJC5]MOʨ0t'tBbv[ZohmSOQ#K,R±hK99"}¶ʅc:eET6ɜ=+j&ٲpPvʏwyA޶:T}N=H*ΕQI(!pҾ#|m Ÿ:O?V2h"D$&JϖТ)z+z^b:+E|#q'Tʲ)z%Qѭ:+'@hhYUKD$)VjxҸPϴ JKk#`z]^D'm+s'4[L. _mo&%2?r&f#*]5QڵVMQE&Ń:7_  Ƽs3 칾Yo9xfrJ{4rR¥NPl4ʔ50zqi aER l"ӠvwChnw^@ifFu^G<*q;L,b\JIv疨||>˫g5+2&ya>VǘZ勚c4#ue5HtH Α*eXs,fўq.B?䝯UTz9rԬvi79: ^I&$=)wrB)tmvf\NLFhmi$tRu bh%d''Y~.roԷĂmIlZʛ^ѡPgu2G:ifB s|^ q9DV⳸y}5~2֭[Ӫ}l(odWrY&AAY^96VǾvJQ$ylkrs𥞍H.X6!8Lj\Mӳq$&ldH㕜R }u>QҮIV)E[[]DPy0Ѫh̻!~\K?s4R٨~Mh}c򏩶e[U%?0f%nĹ+)6lWQȶgQ0˟9)x]`7l:*Um܋+)u&X]uj<+l'$]hʷ?{TWڎ~gz¸ZHMIї, 4Xq;Y"geOnC'"STv7N`"iĤ3"[{ƉՉ_oSMBGkV5&ZT׿~ZwD(eGl[ݫqIl̐f$-"Q/C9MC4W\&m*I mClELp'͚>op}nfJ{3DX>Q([TWf4׹hgV"T=3Y7kqBop#xǍct\i[e@mS>omom?wWvҗ!r0o&RvS7MGo2C2]-sLάvy'Xa*|7%UxtI]MǍj .r{NiTI'9hh%8R}3iE"> 9"!:aJ_7]Nb_5)m#IbnuIucVF葈׫k8Q~s[_!htfʜ?Y]{Yb qN=mWMcijǕtR.ACkwӦ#miZ-2_1ʸLb5(< Ymec5!-f$.ZH=gpZ*Mw~\!-\׵Ym" ;f*di,nnrcܒ_4%אg00,en gҋ:231!+b@"ެ4Јn<@ zswx_Θ9/A k` &>|G&L&EE!*XÛHb.D5%Vj=#cFN 1ur?P-LD㙝hKdq2Ub"D;3)̥3ʚ`BܙЙ9E+ġb3nd,.)j$e " oxݤg1/V2qMq/<%rBP*C|ݜGRDH HF;Lcߣx4P0Gۯ3cx?Tf:xL<:[email protected]6+ ` [email protected]@Y\ԉ|U8eNoYTs~=oO_G'z+Fki)g֪c!eYċn0u(!ɬ̚1 b{UOF#EQs`yfA=j!P9aYO۬U):P8.K3On B{g_[{ nm~x/Eަv51Ne.Z.jnTu +4U(&E4C|gHzsX-ӉVo#:r Kaqvetν+V-yj)Гu݇n"Vk}7bU1v=Ez _SDV(в3fRZ#DU =RʨHUȩ ӳ*=sQt4eU"u봜F±,6Y9SC>#"{OkNPEEWj44mBV:7"cm[email protected]Lš^YooKKC7mnЦn$sK [0jG\հUU%u[b[TJVVLa1[k+DŽsmxr`DR/jW5YtS:Z]Gݕxt=Y3mM *'T96E5e"~&-O,[U/{kSOу,stD o~0rf8GԮ7Yi 2Y*,Nǻe&Wng)h^K:ߩU%G©}SUIdt7S4'DT=C&dP3Pm9\f3$ay^.bsY5t'!["F"IEhuDlp7Cgvڼ"I/*%c %Jp0>ߥi$ hfOI>tyeqzn^%sEYla:N\cй55y31WhЌتGpT$(ItE\gG9[r;\i+t;GYfSOe2쒇Ra-D[,FE=c>PkPtJ#2+t-;bI{םE|dNtzVpNWtC{)6'/;={fFV;̭KEn""e*^hRzťXZ 5FLD{Gy> )boL-"Qr0ՂתO<2 r4~Ԋ$DhڻfsC83Ӭ|8W.fɘɒFi%IC(rk7(ԋM^pkƋhvE{$ Ҧ]0*'/Z=*WܕEVv/~9ZƇalQDwTN1v==E|2gTU谒 rm1!FfT][email protected]As*T ZV-__ߡ#i Xh4;mz7%؞0HZYCEuntgT NTqS XAiXMFSv"kAYD&TP^]nn=qyU>V!ɸUuХcJh ʎiZ)oXLm;l_ i}y$G[flsy'jFP79NhE:}]?W`j?4Ld}Xb߹yGo1Cs"+Raޥ)1N+w(] SD֘:]f@YHE#%4/->"12rFyZWXVz[wh7;hg(U9 rbxe9i+̢RoCȐC'95H wn-rʚlV(K}vŎ(5W2QGA9}"@]'Wױo8dtf{PVd/,ƽI8DlI-vM`,iRUY{:.,$S7K;΃G I{^Kiʫ<5mtA4u1uMbzhyas$fqy=#a9 3Ӏ4ڬr:K.,js_s=Ӆ1(ZK*&yAixv.4Lƅr0ZHj*RkZ[%2YH*|{k&LLR#Uax4LCo|.X\sc*QWZp" DhU|~2ư:{jGͫ[< *uQ~I}Ь *\adSұ93dz_6zG:k]*`l4tZ}JELhW٪S+jQ st$Q-ȓ &]C>L`/4c3_:NuVklB*gfMVŰVNs.{d\c"Z_wLBң:`V[6&Xb!&M+Zw@]XEyJ3%b^j2|fy^,kbHPL갖xʤ_1mwRwCevZ$MOs偭MmǹC ,$YWY%tuQHxotYp80 K]Rb)0 Bڧ:l{E[%{ݹ}^EVQй0GXUi*ze(?r$xU:5Ѝ.JVpK5O=LʀYsWn6L<JRvf&9۳L1J9%gO IѲrף? Ulҷ(nۧ>|ʡR)X-*'󌱬9^Ł3j6CcJ]T_yxt+ʁ4 殺YXw`c&N;ߵJͩg[(e6LǞ;. ( i#%΃V^8~>%?ts: X~pv,!S-9y40Jvz+iO`K_,j *[vރ̂P$7=2A؛]/)#]nPztJ)uӷU/X( zΌcӰT'OYcXl؆DmoHٙ>v"P;q8|^)Oٕr=:v)gTzT8\q;PW[email protected]ƂeE5$'$H {yNSPl)D9!E"D>n}G;R"(Ak<u)]W$1/(t =)l}"3ٳךf.)H)$$QDŽD鈔(g[/%e+#v%%%qd*el,RD+TbuCak0lN2k1ʔLG ~}"??OҬ`[email protected]|+C_Zd񋬶`#xb&a7?"?_OƱVQ6̙d_=FQ/ޠ@H {wv}A͊)}+DWSʴVR-` *.TH:k<͋N۴Ov8/~R-,,t/h AA]?N 3|"Ғ ô+ٷ-#r&`eVr* Ja0nAÀz6 9?9zEȇ8Z(Q1ٗ]D=tc}=uKKU7^ޠ R9=BLsR?gbpHw1 =w"DDVzW' cx :9‚*wRCCǢw]}@-*pD;JL("ݨ-LY$I2&>=> "dS$Rꙙ"N(SG]S$ {U$?hbx *zǑXSIH:u2S~:v1Mz?'~G`񋔜 q|i=J"zD{4O˂w\*Sd 鮤>rh} &P\tG}~[email protected])%%et%9TDPG{&D>(Q;$ԺTXFCM R0#?"@Gȣ W"KQ1~YFNw_QCa/?="+>_wwn;z^!="?W`1AlD#JttURQN̑8z*b.J(uJqg9RI]UHaH !?Ө>(D{ED`"JX]dzRAD}@=_]Ҿ"`S"WSfMӨAdt4hY~ueeɈmǠ}LM'fg/,q=<PGק70?ujc9c{<:^]R(^;vONjw|LC ;" ?8v*VS}{ǂpv}g3=*~Q*X+ 4=SuVT2&(w"ʟPe({ǡۼAD/x} Q^T! .].cfI?)< A6hTW'(ɝ%P*5S0DQ%9 ӵmQf_!7SaH=CRp}<|ݐjEܬtHʚd0i$[ 0B3A5F! Y'=z:lDfԠwN+h):TJ: @DP)Ve g#w9D;\8p.UeN>cX{[email protected]zz|OO;^W_8ms}MqĵXu_h5\J{CN~̻FqCfIQjCCCF &[email protected]_o٨qNoP.~'Q oz;D[#נMC.ONCvTgJNOH>b bC:fz N.ҙ@AHQE R&e1s@!PG8C>2T~" "QuDt;$Oݒn"1fQ -Z xeT,=ts=?!:>/zp l7m\z&vzL=1YU,DX&P=]8X;##ԨE6gtAQ4m&LWx6쑳2$j'DH|wxd5^nUC {A`ߦiIvQm1w$QK Ω%aZ޽H%ÍԻ#|mK=0rGsq9 e F ȏu,Y3JF] bRr?]+A 2v hG%~9q38u5땶*[#;q7i}?'i,!Xnu²r1{ Ko4R<E^ ;]#.PN)-preGM"uj祅N$5 }Y.EVHTM!0m.G$kMbj`o7LI'.}_3hSgJ|Ō _q^KWxg&tcZ;[^ln\2zJ":t/_ },U*5)2# }(WX^bePEܤ?|rQu7!P) ؖkzDA CP CSL"aڏ9!xZ#:|HV9A#-JE,-_JȢ<1<:^>m:7~cfjU9{L~1=yYT1YsH]Ԧ !#*BV>ۻjOب-3A}cd#J3:2Q*xx<lr pSPP}w f' UkKDW[P7m*:))v:*̢DQCLsD0=~`?'bw."b5Q#bD;;xm5}Ɯy0>!<3#?UGc-Rea'OCR(5l/§7A@W3vUl! 5S>OSh)4B$SȠNq.G wwcuyHe-:@*^67G_uO?}#>XajACXJ,$LN%W 2o$!PMVٓ4 6ڤD(JPB& I1w)} 6u9CxSP^2n\JAL{b_y6i&^?GҕrY~2r3@&?E:OPyz+a7sȇ_)& `aGD h ~(o.">#SC=U $tK$%& yʩDCwihˏ_  >0$s&;X`7~D,@}w#jQc+M/]t"=;|O1bR%9G)l&$ͦ+ؽFDML=۬Tg6&wcw&#ӧEM`ZB=B7zrMLGP152 8Wngorۡud*W#ukΖ*Gvs"S8Mz><_^P?x#X;.@?v$գu:X-ۦeVP!D~{y'30P'\d} b{E{۠={CfzA `2`~,$I=_KG?Oz>G}G_V+ iVQ2 z`޺)TS]No,,HbZx"9.Cd)zq&9G{G cl%Nz@>CPuN ByT+y|@URȩ<*&=?7e)"ȷLW75@.CKÔGb0`?;{ x ,x+(^'{tvF<Ii_ >gN_elHs_rW+AӉ_31~#RQ5T(ȩD{3#tvL#Wj2nN ?]ċOg9A"_N6305*A.f2pMJHQ/!n&0S/ #tȸjzf+fKV|tNrp)1֣'=2GB;ViƧLdzqz=c@G*CTMBbGi(ԤQFEm!vU>{czG7;}#ǼD~u?^L?C>G_O?/(TW(ʃ+ҭRwlv90,Re#!Rx.Wa$o_XhwqL~^pCGqHNoo\|x:FegdpRE\ 9uqG׶L"NHUk.)i.cpR!)嵫I!M#rEJrC/iU2VV{Zj-qL(KJ؛5 |.#&f *kEܯr,cKסeGGM]T(b3xRXS[G#3Mפ[u|\nT]rҪMIm8E7۬II9ysW"Ɇ&,b R\iUJ x]"2̾{Er+kG3MAŃ2x,-ݜNT( #9ѯ~`>}#S9RE2tZ匀4Niɧ*KĬerc<Yg7K'ҙGѤ8C,סMd׸O\QvvqԐr':I&W| *("+09[tf''a(}PB9p<ˋS)zB^;S7s]-gmWV6],Taa9fd*vw"Uؒ2nAm*7DG ctT4bYUE3MSye񽖐P(~R'cd~xuKH)MM"SrDC)q%(wT]Ӄ9@P_B(巐t[lY#SSq=J`n~qzЯ<=|(BM,=\)@|U*%h %~T"LՀb#y `/J50==1C |@s"ړzD]7NbR'Z*z `BT^!{$۸9 05t"P(DCǿ@ST\( zu pZ>T"ݗ?T@PZM!?Q/wN*02 JbA'pv[email protected]H` BoP|MtQ0%P讑dLQ3؍Ѭm R=m6Оqrֿ9F[email protected]D LƋ_+׸{)X,uS!tǧV뗪+n@Ϊ WfQI:!ԲHH U)ɀ:{RInYぼ5+ Nj OٜSCzu֋v)3(q1qHB=:obaLzTb(H3.S7$ ԽԛT(AݛdF(:2;Qv)ESR3DG =ؾ. @QrpD=~ A|~_ x~|ۀQba;n-, = 2YHtDzwz<>Gű'XUI%@@7=?XzG_D;t=Cۧ۠wnStL.ۧ^*{4X!qmSuYaBaC; Y*r$2b¡蜦䢳ZoͳTS){ Kkl;w%$ް* qWYD59i_\y#ȺE^jo|> :R.F\Sd6b$*ek 2~NZvI_Fo|'iv*ijq󬣲Ԣ[a!g6D77wNJi/ S+.6HI;䭍*UۼAӑ:iTD +,JMKg6,ىr#JfJutnQ3>*S<"'go)wx|RUޔ&Tr ce >Սpt,]2qU\~(T?8oybJWYféTHpmגZv­ҭI_!5YMԪfj4${:61_ |8l=:=bYqbRN-^JrnR7˜՛37]P|v$FGnC/ i%L&0v%r+'Gu*mesg( #"J a2iPnSxj1&v< HDTT@J.hrE DzzǨVg Sce(C|cmH޳s(& !WHJLw6TdS)IjLR tOOױgXЩ,"VZ8DCk4q;MAUH8g^ rקi_P0Tٻs{@csmyx9'#%3'o:KxKRCtS|5ޡ'Eu?dWb, $ƂM?I<7؋B @%I3O ,0G9E27)R%eM&KW T 6zs:z4V=рgWR.@lSXKv/xNC&BA&&IC^$PCv)PX) ԚE ]HtP(wcgPvI =C8rC1<륅.C9ErQ8ucCU rTG0j?bXBD Q"E:S{bG|=WwaMZA`@n>zTMԞ7pt[email protected]{=%L'Խ:Dt;OO! A)JT3t+:z:]݉7?@HtBרv8mB);PPs 0tC`觎2[email protected]{Z]<#?j Pn]^{)SP3u"` 8QŴ78 (zw0Vq*~H҄q Jx 0m`?]Q:RkҗfQqKu7Y_dMc;c| fC"׏ 8noZR F<,ģ6F P)tdxW\du ~ ߢ-Pۣnc /ԡ"@vOg<t[ѽ^IAp@E6_N uQ}TDAtzAۣVL}~[{%p%-UGF.ԏ < : =>~޻ڝqP~}zv}C۠z( z~]݀(ux;zv޾O_o}}?P_8ߘ{~o_OO4uj4$NP:UqkG "` ֫פ;W‹G͗nS'}Y3$:Zl̿ f:Y ^[aVD'7%mڅ{)kOari;Y2 T #XEnIf_1m $*tV [IĸUv(gIIOR+kOEe- o7'.(~31 b=xqe:g"aR2ډH:! d5´15y(Yn>%;[[email protected]nYj5QT8vٝv-W ʫyszvlЋ[}Tó?ehl*=V)' qk<+sD mUmbK2Vl})wσۺ=p)iQZ>eZX1,杦ԉ`Wzv{^V>VZ뙫Z,&D=d.A>TT+d.7!hjcF*ξ9P3S0ȺU:m3ulrn}cǶT=Irrnյ˞[A[*#d{brQ=e(B)+x NjrϹ;tx*!! iͳ 9+lxP닒P )qT:bVyKbr7VҴzcju~TaS~yF#-T?iۋJ*.B2K}^sEq._HϯsRJ0qYiKNl0RE=3Qd|if Z>dm:|FhY#7Pxab ޱceV+nWmNx=4mkGg)idbbʷr+rSn]){cZ2UnŽ[_57>ZEHtΌ\bd2EUYul QQOh PޠaZ,YğsM3D:E5:mN f9o1sDkD,A39G#VZT2@!:==ð241f[email protected]@`<&>C@#3A۩C21J"d2j@ cq/۹ %'w_lp0X˹U=>~"Ue'uu'!G \]{/@h{o2JRA~797^U=zjQ.ImYX%5I4s?j b: EP{u0/c;[email protected]vEgZj%AFɼ0O*??r\zR%0u(M^8 ?|*?x)*igk NLD(#q00S1b!"S)`__}^:њqۅen(t>ExH9R"+"~E'`Cfp = vjW4 lʓ9pGzf : Di7"$"i_tIyؤ^a?<ş>sW/QyU"P!<<=>~??={zz>@zz{G_}_7|>|۸@"?Ot}cw!C;t?X~޾\?hڴ)fT퇊0X43<`b#ް ձ*bnm7rDyY ڻJ "&udf]"_d ,T|xФLAt=2Lv֜?eh+E'TVNM"_$Pb2(7^?< r`m&]C=7S#>9 ޲y"Fk;[[D(v'Zb3pNdݺy X/.~ʎXZF#­Ew!RnòI]\  znI|?㓓 |S>sUD1Tb<5hu,`*b>j3_2;?ڣ^>qW/.џaԊ}/l0FE!8w_$bږi!<@E x.Y-JezvY!˸։:!ERrJnmlDZTX'Tjs 3rbqWFP"sɺ㚓)#1&.gW2,}.Tdl`𸶵~|#o^~,yj0zFEM߶9䨱XˆĠ0Ρ9=jn9ޒZDh&/B֭wSI!_nG *f8=~,mrwZUܲ Vr[T%b7lx"ͲFN~4vcGJhuo诶O\W#涴c MZ8%.{cֲ g%bU\W>H2(L{2]fɢFs*6twE־e\ aۑ&%CoM4[rfFLzܒO)pt%OjY=]~Dv <•cGݖHy=fmU$'HPl/ɦ4ϗg2 7+a i;5`QVY\v56S7O-ݦ`8ƫS`vy™O$Ii*=­۠^۴E"ݫDJ!)C1(ZVF9I$s> ^-xDw DQj8Μz ho& &%^?`e )촔>bk"~(@tMxG +Na)g!*o0HbDD;x&9cG o[]y3zfStt(ÀYu)L=DE p 2\f_Y Z%H=+RG*vQUNc̢01s scz5UDDK"s&jzP)B D."&I_i%Jؘwv+I6O5W ǽO.Q8wz7~Gz|G'eS_#Q\!ԫ N UEddIBR(b`+󶇵(o xD:9B<,d@< ^YeZ;@PXJg%0wz:v/ ~~HuO_+W\-I&b˵R65I|\U]9ScE*T= wfubq(݂w3Kθ8%rh JkWn'E9Q4=plIlɖ^`k*+:o~)2خDL٪9KH` /Dr+>)'##,_}5XH֯@hQQ"G>kC`:Kh[email protected]~⓱ǷyW~5<']05rNBWa2KQxGYIN!![nҜwqM$'l* 5 ԧ(M-2J=9^]ҌPb@Z7z"Dv'2xC3%eAtJe]C(TuئjZP\Dнشk1е;%K2/sE@ceeMW'%/CuB/=q:U9h&oIfm_m3bՠjfU#Rz_YVfdm/hcZSԊ'z='ZD$K uf`n [n eZ28P\;pP!D؞e-Ww3مO/4j7,80]dXvO( L:|Df8/qޯ-MM+4 ,r6v}=Rl)QU$oZ3syM6й(JDNU%l\ρmt-UH#(EE2(֫KO -w=r3Aj*A:šF32&,)*py}/g**2Yx0poT{ABznOY4Ѯ}oAGoehe /&5xW5InXˬ5;[email protected]2*ƭAT;Rz^ fY/kdYpQ$QJ_lͲ@E*.}_q"@_wgU-s:\%C޲Rk\L+3$LeP&Cw{M۶@'ƓNX4)=a֛`&[:yUa^VL:rؑU Cޝi'W3@y.xUQr9Ta9z>bQ#e1(P(ĭt*8UW E:򿗷@żK٤H1Aj;(=_+S"ry#'mLDI4JvK<9>qêoרp{+;Rt*AzDI>"[email protected]R$pzvۧuG@og1U(lwx]B@#wwF*9PV""# t#$ԑe$TQ`1!>?da$Y$J ̢d:}d'9y좤t3 ;WCn vz:?%v-ON=?XzG_]C6=c2V/FWT+4VJӉwl='KWIB3MXt#\Uq;t m|WC;)6)\iV^1-ɲYb> 8pJkuWc5R_xv/`_$δ53d+" u(t~&W4>l MULylj6楧]S5|V901jiPtt]S HN'1owU(/ϑ٘knP劵XP%XЧ27 JAI_ s76q[?7\a.SDf}B'G?q\VF3JRg$x堽A{ui~CboOק 3TlLNmYT\RJ7 }s=YƠM)cLs)qz@~&mIFL /cfz]o.P?c_Qd9B[\#4IF<$.*Eve>in]MG*9[Ve%GSH7)®Vi:?0)|rB[vz EXsKqP T :h$:N6q/(8*ͯ?*wfW=o_u?d%gld,-^]o&eWƸgxTi5$yJ/Wm7#fDY(ݷvd۩[̳/M }!~#8d+\sY0ť,X!ޭ& HԞHKвoկEcJ#2f}>hOW9*80B=:1;bWo:F^XTV cE' /ZXݖ߮q&bKE 떊Y=-sWK.ƺh'Sn|7~>Yک[>/X(qk 7HS[BGH0rQ\۫ȼSf-πJ-ۘ5 7y5p (;l{g _z_;nj gM=4jZ><%0cO#1VL5e'Wi_6q?˻ʕqH{:G2kBFI2EQ c]@ZSQ/x覺2xn"\>/Q!Mt?j8r= jqZbe^]q1L `Cu=;,hT4#el 06&T"oi]&^u^ΒR5d :Lobnb$L @;#at;SF58&It"E <=6I2X9lc1GBpv#ABxDz_bܒCՁwWe0R`˧ҫ5NN_»1sxAu QO0wk#Q([email protected]:PDLG&QS ԠJ:8D:ʬ{.Bk92~zA~`whxQ@ SȻ'_LjBNءR_$ug%1߸uLQ;~_=v_#~C__WP}ޯ?}}{w.0/o?vx}_-!"ɸ6M_'Upt$n@:% xoͺ4%h kA0 /TATk,#/P *6=:N]J FT/PP/&$J:ߺY҄/pi0$@Pڹ RN%"0aAT0ڿft9Er eЄ*P1ՊШ:2ǡMG7QRUd`1LSIB CD ";u>SȦ]'5yFaCA}b ޿BH"AQe")&_:B169N m O̍uxqU1q\ʉ'G>WQgd!-nPIBA lSc\E.ə!݉(3u mfؔUl{<]♎Pz:~Gzv4fZL?4G7x;7P %NN4X ~;s[email protected]𘊤p p2N^rXv7'a4\g!R4JMJ/aBV?n[EPX4۸k/tJ43s@_vbQDYt7F1sbx-:dZhI,1}d!^sN9&E Qp98vW![28t3*==GL"H7t8R/p!vPP>bB7_ۧv#WoOA}Co_'/_o_I"UT04)0!LsG{݉}Al |#Z L(s$F!o~OS*t# \3zð1Y3)RAtፏ#vP3z~JL#PnԒ6E Qw$:]C($LDI>;P fB ݨ1Չf<=Tw^:GVf0>&ee@*AE"雒} /x?ۻ~z1e_OgOcMC_OAr@$ -yȤpq\j]=F>~*(sSCLs1n+O0TSy/L#䚏_IjtGԣQPa1sOr:\gECtMDHMT!U%"Sg5`%zX:z%,t+>u~rr ̚a!"=K:(y;~:cYpʉ:S Qlt:!U2}NJk$1җFeͪ@'V&R3gH31ʚu:E"'n+>SgrmڦDРiJ$ aՔUzzv>>{Gn/>>1ob/ARMbDc$=D&7O}{z⪥ؕ@\O=LH`r0"yMoS9E3-2b#Ԯ']*={Ǡ^]9\&:˨uT0DDDGwuǴ]E02rOkԦ+ jB-ЬGԻCaV*r1nEI]1Yi†<_>8P:*aQ>҈54ET xr۾`䟳r;r@@>OwW A(9\9J>~E[T4EQ LmD?>|tdA00P1LQ?8w#;HDZ3 1\uwzzncn`q~`,Fw,&w"~╲&@u}z2+x#_ [f z⧕rVh;I`jإvE!)@{ /$MUIe\B8򓒏QD (UHJHJ ^=չY(rf5䒩*Yסj̢"~B^"aoGO??z#~?/?OnޯG6,= DR:0)bV kSfL;#;t={FjYh?o#)l? )~Ж"Q:Yb2%7ٳ*٘MMU0&7fsfvꩳڰ,?IZR )"͒2_8*i9@OBەtf6qM+ȉG*0UPqIWAt(n ::)L:vgIGd0ub=>?܇?>v7!eo_zL:KׯO=֏(es=֏(es=֏(es[m"# u윔vzr+Dr. >GbL[^兩Y=aș s>*-'vfamw')ğtgP讥tLF>1qcND6P~|UX͝as,2Ŗ[q#$m+fqVIɇ*UDTA%LJI2!; db7PMUފ;}o;wtuY]Ǟ IV^ܤGCƂ4.P_ )xb&aHvBa)_<' :J-* &VMhz'JO`B$ _YPBY`L[kVuO*4!̪I\8'>:VfP,]JrSpwo g[>JFٵCD H* {)xUa&V&wH*R,9DJbNG>9bQh"]…I2 GٴLiHotG(NMS!+}F~s{/G{tӱSL9 R)@DD{&1J" 9L/`Eԣ$QvuE1D9I_hz^ Qzu#bPz#&1a0DcD B"#""#؎do@crtA7GMg^/){Z.^n14H맋  [email protected]Hyt"6mݵIU\UnG9C׷Y ~(EڜpGB"d7ء F79}NV<ԽJq&f={&kD pkh>dİ-"!˻]gKr7T8O_Լ2J =: e;E~MSOUʺ\yH; =; HKh(&<"ZpQg~r:B!E:l8cpMJ3#t4nH[4"? 7^#VvN.*`=HįqI/)AWn.AkST蛔GT78ޚ9IF UAI:Ҫߠ~* PDIHZY (IxݩL 6I(sD:RzGwnǯQZFc,tDB~UND: xN`!@Y)4i @})`%?|usr+Gء%z#נ{@C_P3h_Y\%q,g˶ EU0ENe9sc=Gt_:}_' cjiԂ') #תU͔84{!f1I5*q+IB&V1؈/Lpӯze,t+@~rM?ѫD7VtSy;Bol\bT!Zec SP;ʪ‚c!Qb1!HiF#`H JnATɴnM]륔8㘩U9==DG M|Ei?~N _)}gvtz͌|70#"&h QS80YuT]cSΪ΢c~}cFB&p]ҋ(?On>_?#?}gq/_ a;GgmT1a |= P(3D=auAHS2\"&P{F鵶$Lg0PdZ=c%Y6_Y'o__9jyj̈y n\81m'5殛:$ XyvP\PXʴf0Q1OQ;Fwssi$>Y[UI>ri'8:[email protected]=G}_'vEItRu;jv,MB7o2CODV[$S6XףE}IUUl%ۮY ɪSp{4dZ6H? e>G=XU5N)P|hv,sGP: # 쀈D~=t:FrQQb[email protected] 3Uݢ'jʸAKS1s;+J*_Sèt#}@1V2lJ("P387EO^0~QGwOVH(wwQ@C N tR7jERS(} ǼHI>MFm 3`ܾ[8(E[email protected] R#">PoPvMF;tRlpMu?`v#|uUVJ.Na0ruKV$zxgdFMYKϡ"C*^aq3$E_B2i^D$Bz|zPAbNL~4Cu"mceTI>?P>7rnU>GN;Dd5TC rwBy1(<c.%Eb =H2!U[ d5+o霦"Hg)g!`>KBV-Z!S<~Y=^e,Ө+=Q섬SKU9bCBHTKئz(M<*(DeglLQilc$(* IUJ`)v;0Mzs Zƪ/0jbS'Ae9!{dL< TKӠv=Pz~:z,}D+J11{}AC;uz::#|u}#zO_ۿOnZ* bTE4(trO9aM01=݅*z˗Moj0JaìFGº*~erǎ ']ӕNGSq^vc.؄X9Ek&vܗퟳT(~~hӝh)fLW)NK?=dlzdMzNHԲ"&-hxbR) GHµ C8Wqs' `^ZQB2}DY`ܟ:[4Q ;8: PbSv{[c[d£ T$1NKӠ{l/0_/PQUĢ*Pc~ZW=U!u9qC7ˑD?HۼwMel!$uTAtԊbA[bNimail protected] ":w4tlib+V QNFQU%U:K&`[email protected])=~BnI8!HPNL E|`_ \ CzPU:-]F"i"i %7kGP E]j1s>I9,[email protected]vDeZj%ÙBW 3:~q8uWOOx{5hɎ= ۬^ r'`5۰@ oL`{`*EL=A'w@{<ڀa"lYק9tT"Ωc[email protected]{GVN6+A]v)#Abh A6of;_0DSО!!|FR]w}*%3{M(u?$$IaQ+GS =A^ <x0W ށ!(AgPG?t?GOOu?OjN<]M370Zqi'_}CtW۠o|}_w>GA}?#|ݺnpp"-$eU9JР""=׷uD3!^sG&f<}&!![email protected]ۨ1fYzLCz `cz=DҐa8 84"_ڠuWHtE$LnD1a&ZmuWl'% 4 %7q "$fASq/ P}E( ~=>J1Rw`T͜9'"S* QD=CC-i~Aζ`3H Pw 9>FRIUY@QnDġ|dAD0OGP=}Q~n^2|=2>Ȣf2j$rQ5 =Jt 9D:M9 S")^c4/OI(I(zJ\dDB/GXSL :H^5zvQ0VR:+&r[email protected])@{*r"s^XJErQIt\Qa,듂j_ d(.[email protected] R351Vi\ڝC`16;h:](8N,̢(ǩ&9?9aG{t0|WaMs׊wu+v*?xz{CM0$l( C "?Ga=S qrjta'l4:t[c,ӆ()CdGөGF&YJ͝ʽz~eAv3w Qeo "Qd>Dzo=ҪTzCTD}b*,cz2ndL;\i>x&&G1:@2_MD;MjJ^VMIA BuAdLջG=XŐ:w{+Btvq1F4L0@=CI6[email protected]8J=޲pPRE2r )V"E²&(Ru_G_ӷOD|jfyU Sa ~`O( SdD{$""?OSNA{t}:~OP~_w?쌥3` =e1jPW.̊"=]3-j bnQl-.vdH0uA E B=Acӄig%tq2nEzۣ2"Bʘ@Ӳ m8ZFMeКHͶAo*8"S?GŦ%nXd*"fcdUpT |$GDK v$EZMRu(UI@.Bt[email protected]K3LYC0$;ٷj`v,>%:YWV7ʮ#{|~?o=Akt<Ŋ~UO_ͣD1P9Q_]ݻG(FSF\{ɒ}6u &A̳pLf/QٖmOU18yN₂c#v],Uj$UHJ=av* F@ɨQL`v5+/E9K_8+))H..6vRj?Pc#SY/&qmRzB=|'7`4\b_9?H *:dgL=]|Q뿒([email protected]?n$B^Po,}]3KJSAwTz+=}a*7RJfЉHBؕT t)"3hBFP=`G"`/Fx|AԠC޲/NQI:u0v0Q"#۠vYB (($~[email protected]&?T>(zxAH$Rx<~7dxHG1D1L?PzP~]>G_uzgfGFӯBhF1/^:lp)wvΧo=^ް:no:_'U(W"}%;)OR(U^L~]?`Wcw'=ݖx89]Õ(acc?8noR{fdy#, Lg%D[*A&!KX"P D9 N==]7vA)ZCHE!$F"E9\ҍ(ȘJ= A0j0:i4/NV7J$X)4)ȃ8B6a5s&' LB>rۉ(M=#[|P}]>~_%dW3˔fTOcԣ=B( jʓ=שo0tQJ/([*tsd3({LIArD֋f{͕4ٻf(I/p`%[a_/k4$X䙱ݕv*TnYlWK8DTX+z<|eb/wN2ju ɵYbQt+)"SB@aסH^0;TkDr%y&,ژ Ŏ&MYcJ9ik**>V م<"&F"j )$$1zx!>cO UH=7{AF`zuLKۤSh8"hx(^S&#U Pznz>)J&1 R1= RD0@R^Œh S. %0'߃@ɻ!^(C~̟S@j)݄Mqovyw~^ҳGJQ[email protected]/-Uz H񈤱{" =JcPvǼ ƍN"P(E@z(>:C@>OӼwDC$D2(qD L?>TmkJw8l.l}uhxz Ě~O|0??~Gv=|~GA}? D#ؾ~G.;%)qzjr*0^,p0DL{)ZfJ"˦aRbS?d"\C5N >0Om!Q0ӲL!U1X`[)zhxRn=;t+{d|3!7A __jQ"w`\:~~{ Hʄsq06d="@Hyg>ˠ?uuP:vP~G?[email protected]""=>qOdeofY2Rh%5$STג?b&0yqtE$\$y=*5??\X%"#zvE`L lRɘ:fPQY @\;=zAۇZ*u?C\"_ɖ|QV6UAI^)Gkx*ة.%\AI#`^gwC7ӮfdStQf<ò͘~`쳅Yª,^%8u1}}2@(0JP&0=cV(*ndrX1OTQnmJRZoE'WEs?Z=?VڧdcVHYWl%;*bEĦQSptΒ4#A@;Eġqf@*ݏ왃LPTS xyHuC´$ 4I>cCzbJT"khW DĠf3BCU`Hu?g$"g|uW7L]:0q OɣL+!c g7D#̔r₪:@M4R:GQXuEBFIH:qzʬ}Gz:v]B@JV-CxH"]4aȪ=Ԣ=Xc $5$ ?Xr1z::?)*pS?xKMTn,{DDDGD}b"=۠v@{t==>o'ܛd+;J7ic?0ah{_}R {x=~7;hTPQenݼ/_)ݝT4$|,ɗGgbЕaRAdIXTti +V(LEr@C~wy{/|<ޞt$,QZ[K*q clU%0R7_4gQnȲաUbg{4I.DNU7n(2z4<#}Jux$ K'D<[7 y{k޾wtoO?ٺG>OMa⇂ TA",Ȭ!Ve)L`0 W]f'31fJ4HR:ӿUذ,b7J;EwX<+Ns(`X~Gxo;Ǡvc2I|8F%&_&$,ʤs1ʰK('ۼ{Oƶ+gKD΋U"]E3NiR84z=^WȗU4! С:AV*> qHE _#@:u;wz?G` +vIƪxBW ;p b.wP0DCDgS?b&_:G6-eV&g(d+q10)?!GG{ 7[\ y1M+.,('*RKUQa3#W*" G>6fVVXA+]*U*"1]ϜYDq%\s"WAY+qv{ YV{ Q7ĢeHTVpU"}v~e!nr$ٜ@xN0{#0ɖ2yↇj6|c؈OQ/B,,Ȉ2$8,~#/23|BίUhkNe Wc*n6In11Tro*>,)t[DV; 1ɶ9Fcc{l62#M\Z{ԢM]@h 1({C.Vŋh/1O45}I k%m=,{ӸIrd*j+#]+l/gMPR0-UjڰXZ%033'l@;U՞av~[}ڵ@ Fi43(sj=%> Ed[email protected]Fip` ?OV~`G{BIvz*DH*c•y5 U'#҉f0TV\Em:mRhVyb U,*.)CNI]"QAUH쬚,cx&8ӯyZ冣S6}їIn'R(cI2uopo!HIeHQP7· xݫ8nD׏V KLFCuQרLKV?^&^j4\lrpާHբ0ȺV?1aFu +˞ihSYC!hg%n1_R+ERJEV2m&k6='={U9BQ)Ү2F{5}+l)qW~8,,wM 9i8!n~2|̷3C˗QtFÎ:AUu: w~9s 湢|6.5M[QС68MWWqΰҩ"<lHrXzf|'[V]31tubq;[ZWۦUQĝ~W`tڼI$?7ң5X٭RaukrȪ**r+/RZrUJl [Qcm.2xq;JĨ񳒜~/3^<#]H.yeuRd$"dcjPLa"f+ {-Y|_u''{S$Եչw%9f77N6G7{3!{r37gЉ8q4!~َ