Improve Your Business

We Offer Great
Number of Finance Services

Marketing Research

Analysis of the market as a whole and its particular components (competitor, consumer, product, etc.)

Organizational Audit

Analysis of internal processes & procedures, staff activity evaluation, evaluation of technologies.

Business Consulting

Successful experience of experts in structuring investment projects, developing and implementing.

Business Consulting

Successful experience of experts in structuring investment projects, developing and implementing.

ExifMM*bj(1r2i ' 'Adobe Photoshop CS6 (Windows)2019:03:04 11:13:18&(. HH Adobe_CMAdobed            P" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?& J\' ,o wn8 =o,~wmi)Nu7cZۃ3y.|I7E{Zz^s K}/{lLDi.ms `,v=You~3-Du^*o^z~phoϠͿOĔ,Α}?s^S͑[email protected]ƹkl6kM%)$IJQ$ruiC=4@R]wGJiu #n/$:nke~d>>g< 8l))GS$P1% okKlڙ#LyRpc];(;wIO& SJfZXꝌܒq4DKYVC]V@xz v]]c+e~տvz˦fS2[email protected]-og鿛"ȷu֊hln鹮5s7쭟jSY]ͪRO<}~ez;6z+1mv)O$$O纕=r/ }cv տmsZ?LenVfFUL%2~nU_Eo[ZZ0;чvƽ;O=eߡlEJīr* vM.s=2?I\տT0=2nglkF2{_c:,AsG H?eĔq"4Jb]GAv5 ˬsD#{ύko0rl88̝;.Y{u \1k[}b<7 .'L$9Veb(~;lMX7kw}r|A 4?dDCvvB*o~ ) dQ];}V=J|JzlsKMK[t_Q7':ݡA.پJФN JfDJJ.pkK  MȦ]kZṾ69)) |{~뺿@`w/؊$p#̕[:x'U0Kv%I)&F=Y<6kK^Kw4;,_eHlOׄ)~7cd_bu{\@1X3<)w? JX9rGLUzp˸k8X(>pw֟SbJlMs@TpR02ȭc.hsE,x]Sw\d㷙Lfds%-j/k{Cþp k)QPhotoshop 3.08BIMZ%G6 Basic RGB8BIM%h֡2ng8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjc Prova Ayar1 proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd [email protected]Grn [email protected]Bl [email protected]BrdTUntF#RltBld UntF#RltRsltUntF#[email protected] vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#[email protected]cropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIMHH8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM?17209nullboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM P  Adobe_CMAdobed            P" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?& J\' ,o wn8 =o,~wmi)Nu7cZۃ3y.|I7E{Zz^s K}/{lLDi.ms `,v=You~3-Du^*o^z~phoϠͿOĔ,Α}?s^S͑[email protected]ƹkl6kM%)$IJQ$ruiC=4@R]wGJiu #n/$:nke~d>>g< 8l))GS$P1% okKlڙ#LyRpc];(;wIO& SJfZXꝌܒq4DKYVC]V@xz v]]c+e~տvz˦fS2[email protected]-og鿛"ȷu֊hln鹮5s7쭟jSY]ͪRO<}~ez;6z+1mv)O$$O纕=r/ }cv տmsZ?LenVfFUL%2~nU_Eo[ZZ0;чvƽ;O=eߡlEJīr* vM.s=2?I\տT0=2nglkF2{_c:,AsG H?eĔq"4Jb]GAv5 ˬsD#{ύko0rl88̝;.Y{u \1k[}b<7 .'L$9Veb(~;lMX7kw}r|A 4?dDCvvB*o~ ) dQ];}V=J|JzlsKMK[t_Q7':ݡA.پJФN JfDJJ.pkK  MȦ]kZṾ69)) |{~뺿@`w/؊$p#̕[:x'U0Kv%I)&F=Y<6kK^Kw4;,_eHlOׄ)~7cd_bu{\@1X3<)w? JX9rGLUzp˸k8X(>pw֟SbJlMs@TpR02ȭc.hsE,x]Sw\d㷙Lfds%-j/k{Cþp k)Q8BIM!UAdobe PhotoshopAdobe Photoshop CS68BIMohttp://ns.adobe.com/xap/1.0/ Basic RGB Cyan Magenta Yellow Black ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGG[email protected],AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ [email protected]و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~[email protected]~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPT[email protected]7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D[email protected]3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т[email protected]( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFz[email protected]{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl[email protected]Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>[email protected]{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-x[email protected] qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty[email protected] >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:[email protected]`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!M[email protected]?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖ[email protected]2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?h[email protected]LAAHoj5ʞi)ț ǍH}ww̷lϳaЮ|Vͪ&Kߥ,@蔬5g)s<{)@bRwHlKaP VV+Kx[email protected]mW5Z)`{}T],˃v3k̲]`᭯FUCK[email protected]`;5($)xq!-v_tcOvjkZ(`cUJפå@&4̞)c#䊇o}s|e*pt+ZzitOnuEfv:ۮ x-/yh#z.{ '~ @ oVye1OyZPz"O`zEe{B:ܭ|/Ȩ|$}l W[n o%e'jZ`4POݵR]E^:۫/ϧ$-6K. meߏDo dپZCOƴ;JEP$:תۄ/զ:$Aҟ8$ K0B oD0dY#OPE:)/ʥ$Q $ ^$nyRd+dYfO$Dέь:!/ċ$^{HI ^#nncǻ,Y9ÓNѱ D*:Pv/9$i|6]  )Ebn cnX+NODJ5:$ؔ/l$t@sg; Z.ZڋmͿtc# XN9D9Dy/xі$ ۚ k!mp1dbֺ%XU"M1C۫r9צƜ/jN$8 ϔɈ[ym֮rbǫHX YMȯƥCX9aN/_䜄$" FuoPvqw_rxsғxu*yYvmAzwYJzxD{Qz.{z{{Sܢsy>tz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv[email protected]ݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\[email protected]bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP[email protected]$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|t[email protected]vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM[email protected]u2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{[email protected]S׀.Ix[email protected]%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/[email protected]sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOg[email protected]jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{[email protected]{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)[email protected]Y2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}[email protected]E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}[email protected]v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ[email protected]߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧[email protected]fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#[email protected]o5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ[email protected]54gt*6!t=| vh$jBPkڥWWmEt8nepUDqnEr4sm!}sC v8ԮhiVkQql:skn(ndRoTpDr*3s!_s* 1u݈gGiE[jӁlLarmcoT=p}gD;q3r!FrĔk Muozc£zfq{*h{hk5v{m[f{oxV3|^quE:|sU3j}6u}v) [~w}x-lxn}5y.p#yqtzseKztU1{vDr{w[2|xM|SyP }|z߮avuvvfmwwEx!xskxxd1yAyTIyzCz{f2h{ |{;|x |}qtq~+\uN~\v~0v~rBw{~c3x! SxxCCyv1zz> "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~[email protected]F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdc[email protected]enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)Ȍ[email protected]ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd'[email protected]ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!Ʉ[email protected]ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}[email protected]}IpW~/<)~/ ~!|9">Rԁv(v[email protected]4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd[email protected]v|6֑w,Nx y%zx1}RVhdњ3x[xR yI[email protected]Q{6s{,| 썷}N~*É:|c~[>~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH [email protected]=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQ[email protected]aI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuy[email protected]XzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}[email protected];ad+fgއ q$MqQ&dWTRsXi9e[$X^ےIa;+d%H+egH gpLьP71TrcWeZ9W^I`;ct+ef̍ pcK\7 OxSUqVأ]dZ4#W9]mIQ`_:b+d4fi p[email protected]AhYq}jf] uk`xgymdcY?nfJ[pyi:qlB*[snsnojy-sc.^Se>ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSr[email protected]iJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}[email protected]_p7bt.xen$Xh#1j xl鉎rxzXޓ}[Pϒ^Ha?쏧dF7f.ij$)k>wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx[email protected] yL=ގz66Vz.k{&ыF|J0}cC~\ ۆ,+K}D~p= 6Us.y7&ŠsT ma0K(#DN[email protected]I5 4.Tg&]B% LH#wJCv<=5.3&ca x܆!҂B]J/0C-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}[email protected]cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_I[email protected]2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyy[email protected]zC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muU[email protected]Wjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} [email protected]}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{[email protected]dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=[email protected]m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhI[email protected]@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}[email protected])}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆ[email protected]"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuz[email protected]_mu2/aou#bq)iryv/HgXLiVsgOkEfS%mZ=VnMQYp?\r!1_Rs"`thu\IxxDo~1Hq2r)LryePEsYaTtLWu?BZv1L]8w"^xj(gyxx{A~x|ExqIyNdMyXQzjLUz>Y{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A [email protected]5[W)].a\k^`_xt[D^'jZH;N`?LUOKS[email protected]WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q[email protected]},i w!KjSxn(ye t{~A~fYWx<]A[xS^yJE`y@cPz76ez,tgb{x!Zh|)Kl| ks~fj}eW-~\Y~SB\~I_~@Ha6c=,ae!pgakk s } dUk[X+RZ˄I]q[email protected]`6b,\d!fSk r|]doŠ@[nV_RbYR[email protected]\?^ɉ6la{r,Zc!ez jm ;r>|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7[email protected]_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTL[email protected]Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |[email protected]wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~<[email protected]~7]y1yk+qy%$y[z,Z&zg<{d|:~%m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGG[email protected],AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GO[email protected]an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћo[email protected]T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢL[email protected]ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/[email protected]֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}[email protected]Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉ[email protected]HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO[email protected]B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[y[email protected]͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot[email protected]P2-$8'w̅{lڂe]߂JN񁦕[email protected]2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņ[email protected];iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠ[email protected]?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj[email protected](sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}[email protected] y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1N[email protected]C6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`y[email protected] zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<[email protected]Üq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs[email protected]GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLL[email protected]R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑp[email protected]}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm[email protected]ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZ[email protected]H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\[email protected]y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~[email protected]ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq[email protected]x;&4z`5|aJ~Te߷pM]0qkTrL?t [email protected]~u<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|[email protected] xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV[email protected]wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}[email protected]}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8[email protected]쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w[email protected]:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧ[email protected]"n93qK2s+wva$fKx{;R}z_Ek[email protected]m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;[email protected]MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?[email protected]y1wy"{yмgwjKil kn8mMo~oqoEpsp_ru(Ptv@vnx1WxJz"z8{dsOg7tiuukqv}omkwn9ohx^qkyOksrz@1uy{1wx||# y}Xb|te7|ng|]i}L|Ck}m>n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtE[email protected]R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { .[email protected]zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| [email protected]|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=yb[email protected]!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJ[email protected]ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoH[email protected]$+-^$[v4m>sdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~[email protected]^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/[email protected]oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yI[email protected]{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku<[email protected]o wHi4pxK\rbyPOt&zNCu{G6w|8*nyt} {'}Jh |>,i|k|tm}[email protected]}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\y[email protected]xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:[email protected]^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7[email protected]/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-[email protected]*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđ[email protected]CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN[email protected]&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@[email protected]`utoWu:NvEwG[email protected]+z`#{w|rp~pgq{c_crÐVsMu(EYvdg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHy[email protected]z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.[email protected]r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG [email protected]t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.[email protected]Q}LE~F:[email protected],: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝[email protected](d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb[email protected]%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Ka[email protected]#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv [email protected]xlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xx[email protected]"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`Dh[email protected]NBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#[email protected]܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|[email protected]<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|[email protected]}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mb[email protected]7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcY[email protected]iFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp][email protected]qNfsEitky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+[email protected]#Etwq/R[email protected]]xMaaTDe8y;i3flc+>p#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5u[email protected]wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/[email protected]qr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azl[email protected]yOa.e*Ti}&(ml!RqSu xg{[email protected]S[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!12[email protected]3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5[email protected]THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)[email protected]HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/B[email protected]UGYN\U_Zd_ڽ`s϶fįmsx}ĉLJdžƇƈĉÉÉÉÉÉÉÉÉÉ +8.C7M>VDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N[email protected]WAZEQ[Yn_einruxzponptvvvvvvvvvv ,9+E1P5Q8R9V6PCPYVm\}afim|pqvlkjjpqqqqqqqqqq,9)F-P0O1O.S)PARWTjX{]adgskjsgffeökllllllllll-:&G)M*K'K J.[email protected]VTWhWyY[]v`jedob~aЏaҠ`ԳefĿfĿfĿfĿfĿfĿfĿfĿfĿfĿ-;"I#H!D?!H5OGSZVkVyUUyVlYd`alazbۈbܖcܥcݷaĨaĨaĨaĨaĨaĨaĨaĨaĨaĨ-<HA2?'G;LNQ`QoP|O}PqRhVb\_f_q_|`އ`ߔaࢢa஡a஡a஡a஡a஡a஡a஡a஡a஡a஡.=@/4?.FAKSMcKqJ}KuLkNdR_X]_\h\q\{\⅞]㑝]㛜]㛜]㛜]㛜]㛜]㛜]㛜]㛜]㛜]㛜/> -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*[email protected]>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7[email protected]LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO[email protected]vIKtPWoWch`majwYt~T~RQPQQRRÅS̅Xτ[҄^ԃa؃dۂd܂d܂d܂d܂d܂d܂d܂d܂w sp.%r94[email protected]>{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%73[email protected]9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB[email protected];M>?N,<<0>:4?8[email protected];@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6[email protected]oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3I[email protected]YJڑaWщggɁnuyts{onoopqq̓sӓtӓuӔuӓuӓuӓuӓuӓuӓuӓuӓs oz$/9 A&H,N3S:ޞYCՖ_ȔfeĈlsrzxusrsttuƗvїwїwїwіwіwіwіwіwіwіwіt o}$/9A#G(M.S4ڢVAЛ]SȔeckqp~v{|wvwwxxyΛyΚyϚyϙyϙyϙyϙyϙyϙyϙyϙu p$/8@ G$M(ߪR-֦S?̠\QÙcaion|ty|zzzz{{̞{̞{͝{͜{͜{͜{͜{͜{͜{͜{͜u q$.8@F L#ܮM*ҩR=ȤZOa_hnmzrv|~}}}~~ɡ~ʡ}ˠ}̞}̞}̞}̞}̞}̞}̞}̞v r#.8?FKٲG(έP;ĨXM`]fllypty~|{ä{Ȥ}ɢ~ʡ~ʡ~ʡ~ʡ~ʡ~ʡ~ʡ~ʡw s#.7>DߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeB[email protected]`e>kdVC[email protected]IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P[email protected]0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+[email protected])[email protected])[email protected])[email protected])[email protected])[email protected])[email protected])[email protected])[email protected]yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-[email protected]dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/[email protected][Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYA[email protected][email protected][email protected][email protected][email protected][email protected][email protected]Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTB[email protected]WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5[email protected][email protected][email protected][@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*[email protected]JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"[email protected]*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1[email protected][M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$[email protected]+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5[email protected][_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|V[email protected]^McY~hczmmvrtsyyr|q}~r}}r~{r~yr~xr~yr|yr{zrzzrzzrzzrzzrzzrzY l{̝֜/œ=H P/W=\JbVfbkl{ot~wv{zu~wuuusurupvovցpvqu~rt|rt|rt|rt|rt|rt|\ o~ߚ ҟȡ-;FO-U;[H`Te_ijmsx}r|rzynykyjzhzgzfz҃gzhyjxjxjxjxjxjx_ r ֝͢å*9DM*T8ZE_Qc]ghzkrro{jveca`__ς_a~b}b}b}b}b}b}c v  ؙѠȦ(7 BK'R6XB]OaZ~eeuiolmxds^}\\[ZZ~Y~Z~\~\~\~\~\~\~gz  ܓӜˤª $4 ?H$O2U?ZK_Wxcboglfku^r{Z|~Y}X|X{WyVxUxVyWzWzWzWzWzWzl~֗ΡŨ0<E!L/RN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=B[email protected]G|@G?H>I>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:[email protected]LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W[email protected]^LcW{g`wli{trowrzttqurqvpqvorvmrvkrvkrulrsnqrnqqnqqnqqnqqnqq[ n { ٍғɗ(7 BK$R2X>]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnAD[email protected]ʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5A[email protected]v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`<[email protected]RsAR|BRBSBSBSBTBTCTCTCUDUDUFUGUGUHUHUHUHUHBP ^gmp$p+ o5 kBfL&`T3[\=XeCWnFWvGW~HWHWHWHXHXIXIYIYJYJYKYLYLZLZLZLZLZLEU clru v&v2 r?nI#hR0cZ<_aD\iI[qL[yM[N[N[N\N\N\O\O]O]P]Q]Q]Q]Q]Q]Q]Q]QI Y gpvy{ {0y=tHoP-jW9f^CbeK`mO_tQ_|S_S_S_T_T_T_U_U_U`V`V`U`U`U`U`U`UL ] j sy|̀.~<zFuN*qU7l\AibJfiQcpUbxWbXbXbYbYbYbZbZbZbZbZbYbYbYbYbYbYO ` m v |  ҂Ȅ,:D{M'wS4rZ?o`IjfQglWfsZe{\e]e]e^e^e^e_e_e_e^e]e]e]e]e]e]R cp y ~ւ͆Ĉ*8 CK$|R1xX=t^GpcPliWio\hw_gagbgb~gc}hc{gczgdyhcyhbyhayh`yh`yh`yh`yh`Ufs{؁цɉ(6 AJ"Q.}W:y\EuaNqfWnl]lsb|k{ezjfxjgvjgtjgsjhqjhpjgpkfqkdqjcqjcqjcqjcqjcWiu~Ԅ͉Ō&4@HO,U8~ZBz_LvdU}si^xpodtnwhqnjonkmnkknkjnkhnkgnjhniingjmfjmfjmfjmfjmf[lxفЇɌ #2>GN)T5[email protected]]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ[email protected]Ò[email protected]Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5[email protected]@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 [email protected]uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tX[email protected]{x^ItucRnrhYipo_enxbcncanc_nc^nc]ob\ob\n`\n_]n^^m]^m]^m]^m]^lw΀ņ+7 AHO)T4}X>v~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7m[email protected]]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A[email protected][email protected]/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 [email protected]cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 [email protected]|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^[email protected][clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^[email protected]|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: [email protected]jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ][email protected]YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z[email protected]$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuAR[email protected][email protected]^[email protected][email protected][email protected]kA|iAgAfAdAcA[email protected]`@`@`@[email protected][email protected]@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ [email protected] ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: [email protected] aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; [email protected]SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28[email protected]s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.[email protected]^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAA[email protected][email protected]IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\[email protected]Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@[email protected]&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8([email protected]&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:[email protected]C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?[email protected]EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98([email protected]'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>[email protected]4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?[email protected][email protected]I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?[email protected]>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?[email protected]0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``[email protected][email protected][email protected][email protected]0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=[email protected]#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#[email protected]W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#[email protected]V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#[email protected]V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"[email protected]U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hS[email protected]BS>ES=IT[email protected]tKQuS_qZmmcyhlcu_~\[[\\]^__Ėcǖfɕh˔kΔkΔkΔkΔkΔkΔkΔkΔkΔ !~2+[email protected]tKQuS_qZmmcyhlcu_~\[[\\]^__Ėcǖfɕh˔kΔkΔkΔkΔkΔkΔkΔkΔkΔ !~2+[email protected]tKQuS_qZmmcyhlcu_~\[[\\]^__Ėcǖfɕh˔kΔkΔkΔkΔkΔkΔkΔkΔkΔ!~2+[email protected]vKQvR_sZlocxjldt`}]\\\]^^_`ėdƖfɖi˕lΕlϕlϕlϕlϕlϕlϕlϕlϕ!2*[email protected]@{JO|Q^yYkt`xoiird{`^^^_`aadĚgƚjəm̙nϙnϙnϙnϙnϙnϙnϙnϙnϙ!2*{@@INQ\Xjz_wugophyc```abcdhĞkƝnɜo̝q̝q̝q̝q̝q̝q̝q̝q̝q̝!2*[email protected]?HMP[Wi^vzetnmvgcabbcegkĠoǠqʟrʠsʡsʡsʡsʡsʡsʡsʡsʡsʡ!2*?=HKOYVg]tcylrtk}fccdefkoģrȢsȣuǤvǤvǤvǤvǤvǤvǤvǤvǤvǤ!2)?:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-[email protected]USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"[email protected]'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E[email protected]5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%[email protected]AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J[email protected]BE;IF8RG6]G4jF2zE0D/C.B-A-A-@-@-@-@-@-@ͣ|sjaX P%%I),C.1=359:75@92H9/Q:-[9*g9(v8%7#7#6"5"5"5"5"5"5"5Įxpf] UMF?!:$$5)'1/).5*+<+(C+%L+#U+ `+m*z*))))))))xlcZQ IB ;51-)" &( #-! 3!: B KU_j x y y y y y yxk_VME >61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<[email protected]1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6[email protected]E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L[email protected]+eI7_SCX]NShVQt[P\Q\R[T[T[U[U[V[W[W]Y`[a\b]b^c^c^c^c^c^cU MUbk"p*t5s>&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;C[email protected]@QA>]B[email protected]:?9>8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>[email protected]B|ABACAD@E@F@F?G?H>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6[email protected]mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1[email protected]^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>[email protected][email protected][email protected][email protected][email protected][email protected]MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>[email protected]F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;[email protected]PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A[email protected]9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-B[email protected]a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(54[email protected]0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;[email protected]WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3[email protected]jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5[email protected]^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7X[email protected]_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{[email protected][email protected]/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =4[email protected]8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@[email protected],>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 [email protected]aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[[email protected][{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn][email protected]]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;[email protected]`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)[email protected]_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:[email protected]CKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1[email protected]/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax[email protected]*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: [email protected]UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_[email protected]_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'[email protected]%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5[email protected].I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU[email protected] ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: [email protected]KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALA[email protected]L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: [email protected]PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?[email protected] oBkC$hB.dB5aA< ^@C \@I[email protected][email protected]V?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: [email protected] VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A[email protected][email protected]??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}B[email protected]p>k>f?[email protected]_B\B&YB.VA5[email protected]; [email protected] N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6[email protected]~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`[email protected]^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69[email protected]N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?[email protected][email protected]j?d>^=Z>U?[email protected]PAMB&JA-GA4[email protected]:[email protected] @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?[email protected]BA@A=A%;A,8A36A9[email protected]1AH0AP.AZ,Ae+Aq)A~'A[email protected][email protected]"?!> < ; :;=?w?[email protected][email protected]\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7[email protected]cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;19[email protected]81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?[email protected];B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?[email protected]]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*[email protected])1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>[email protected]!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>[email protected]cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3[email protected]tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6[email protected]DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?[email protected][email protected][email protected]>?[email protected]/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 [email protected]!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 37[email protected]2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5[email protected]UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+45[email protected]4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkih[email protected]=?6=[email protected]EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1[email protected]QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h[email protected]_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0[email protected]PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2[email protected]VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4[email protected]ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1[email protected]WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)[email protected]MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c[email protected][7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5[email protected]j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*Ӻ[email protected]ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3[email protected]x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-[email protected]UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNA[email protected][email protected]K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA[email protected]z?6>5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8[email protected]PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$[email protected]_J6[email protected]VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2[email protected]{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;Dw[email protected]H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4[email protected]`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0[email protected]\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DA[email protected][email protected]@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#[email protected])>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K[email protected]'YJ2UW;QbCOnGOzIOJOKOKOLOMPMPMQMRMQNTJUFWCXAX?X?X?X?X?X?HIVah#k+k4i>#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0[email protected]^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3[email protected]\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A[email protected]>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6[email protected]&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?W[email protected]lL'eV7_^D[gLYpQYzRYSYSYTZTZT[T[T[T[U]P_LaIaEaDaDaDaDaDDT b muy!{({1 z>tJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6c[email protected][[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;T[email protected]WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^[email protected]\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8[email protected]aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{[email protected]{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A[email protected]/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICD[email protected]R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[[email protected]ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A[email protected],?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 [email protected]wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^[email protected]EUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |[email protected]veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 [email protected]HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 [email protected]zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 [email protected]gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: [email protected]TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmA[email protected][email protected][email protected]:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 [email protected]jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ][email protected]YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ [email protected] ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:[email protected] }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< [email protected] h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 [email protected] aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: [email protected]SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17[email protected]t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-[email protected]^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b9[email protected]3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\[email protected]Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@mail protected]$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:[email protected]C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaF[email protected]P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:82888[email protected]48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@[email protected][email protected]#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7[email protected]cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5[email protected]uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJE[email protected]l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtF[email protected]^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98([email protected]&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E[email protected]-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5[email protected]gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGE[email protected]o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwE[email protected]b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{E[email protected]f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>[email protected][\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>[email protected]\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķ[email protected]#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* [email protected]^}t [email protected]}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$h'u|*y8Xg@f2 䮋oVle|Fa1b&Eă7N/I|t+Q;QI!1-o}q?8+_^o?Z!1-Kqyw'xd:;dU`^2 :P/d6w_?tg~neb3 d\3 |hWDnٳWM΄n1@1bZUV*-~k=ccϷG>_}/Sl6s|4׺#쇕Yw{|Ot_^>~wݻoHim'>{[꿭3gwR4Yh| ݿ߇ftƮr4ks(*b&tC d]0h.Jk=#)]|RD.^Fq^/[6arẈda,` -)0]|w4٢Yt" At]+evAʠ0 -B٠qpPI:t|$]qھ<{&9!Xv|qvxuuߣ^z_/(}>#_kq^5N;WwgW<Ϡ>kvR?{9_k>/o=tpSDfrq /2B ܲc]ڈTEQ: ƬTqW9>x.ul(܄Y(|`>pQ f-i:bD-Gl|Cxay%9^f9.N'X_[sWRsn6l]ѤݜogW6'NoNw_^&8imoӎ޼}qc~ =JIwWW_zg+/g'bSض̥9i kw]K`"$j(l2[email protected]4|3T:rfJ*'Q8pFP 9Hj&h.u֑gYThG/V%QhRj F˃_~ Ҳ=نc O~m? ~?Ggm#t5GK Z;D_&ړ>}o:Wז{?xAz1/~zOԯN[7濻.&w]K`.WIv|g8QNj4\.'Q8s^mG5Fpz.z?nqykiTn2X1>qI un<~nwV՜-ny/{˃q3ܽ-rT:V0.mn$ woW>8nOuO_>RYzq\['kS,zcn#yy^:B|}G>hd^%Y =쾶z|= [email protected]+'ug&@?}p@gh @6Cg]l:!Qg^3bx>=u_KjZ ^X1>qIY[};~_ikti^}ҝ}_N;W}s)%Nf9J[?<\'F?7w֯?uOg>-^RgJuoW>c/W;7}7 >O۽PzG+|돕?YyY?5q긩*bƮf,nSxo L/ lN .[6 wnu@e6FH+3l]xĪ9,Z0)5QPX1٢Ȳس uh嵿W>Ȯ{wwu7yt-4 ӤNFkn9^"H].wcr5/~gwS:`]쭥ѧ:pu϶i+ߕ]?ͽ4~xF G'گ'闔_[uvTt!hN2h wFO+\[pE u!.6zgOk584KQucU @-@P`,{GSs2,q-Oި#K)>7usI]yw ~;V%=SϹֲL'}_;y-s.>~'S?y~/ݣuDOx_7ks.UdN?9>[L9bpw+ǿ>|w{oKI}{uz@N l%\tF&h޻L%Њ[/._] At]T)vBm8 ]YɆjY+x.]ͥ  (0 MTT @;o<=g䩧 ;y6ݝw) uޑ,;u'g>\=Zy]WϹwO7chG==o8w<>~yݽaGΜ6ѳ6=}>uWg75yaw:)םI}wXu(>罪/yt-C,5q*8ɨ$1G]fN`U8 vBf8̬[|R#Djr]U,I}dV3]лbą8,FZ,EF5QhRj Fe[Y!`hSK_#hti2ǛB>wk'F>vzCaޭ1>}`ް>}xzzz'M3Z[NЂ[Ɖ-uG99* `z*>ѯ̶.&8K0 K7]xחN?gʆaf^z/#79&uda8-B@Z0 |rzy]|_tez}}XmFN1}?.+oSL-p^1 h {  շxvz9xz=NmMhޜu7~?YGw{\wO[ kGrPg-y9:"o:>K~-w#;_U}o?܍mo>imsϚؼ>ǯuG`V^xKy~ǧ0q 2"UwD' }-V%3KB393l+E(WWܲ199ֈ2 O]VԶ0RiV%Q8( f&=.}5Žj}8zL}ӯmlM-"'g5Ybp}_.N;%[WK>'L}s1{R=7ݷ..N-omG},@9j[;·`[weg뷥ncн}ߏtsIr; >W΂~8-q /Xq^&qTgmed4skg!ќ[email protected]%19>x&5D&q\%389sE1 ٣߿yqھ孅Fz\]=~MAͼ^auy){9z-!<=]ܽݼ=]ztl}_/~C |ﵽ}8KE3 闷w?^/Щ~:e8|_Uo $hОW @qPEz+Pd.+$]oSyu^n ߲5C AaC3 ӥL(+fQ%pa,`-h٢Ⱥؐc`_3qy}o^ۃEh|Cӫ c.n?S=;,uw罏3?_'WFF іj>Ir`{^g{~YϢ9~|菺~' ˾Խ7Ѩ7F[?>C"?-<C upW|ϟ[_AzR vIcW?5幕( thFL.|t}t}lzozGzԽr3 e(W0F6%L2 faAchEAcb BI٨1`(<{WuWt.ر҄n.j ]Md&q},Qt\ɥvksa^5|ʀ>L#TFrd&2+6]2>xi-@0 !l8 f[email protected]hl-xtdDm8.Jm!(lՋ.$Y@F]{` 8F/½/e,FX([90h@1Q [email protected]swk|iIG\.Dl5S~}8thv.ƭ{nu tjl(UUt1t.zheQKTBrga0B#9x.׌ a@bb!E,U&BRaD7G67xAwc÷y8|vW?Gz{'}_kF;"юW8eVG6=:dP, L#DBrI :(.U3[email protected]((F2 \j3}eP!` !+HN '%}5;|f=̆Nj޾}lJuѭ'xm#6m2:8Og.5cG}9:`6;GOukx:٬OlWKꮾ}IlmD `:qŵdt9pm.N9ztmnN/z@ ,ι˃ݝfXua呩EĂƺƈT 6B}ͱԃNoPgt]T)TjN*2 |lN,0WdJje_k2:B/lVbA{_SO*:q~s;z~nDiqڽ{: }x^/z #_=4zey'>9.1Cu>ޞF}{{=c瑾zLvavoc|y?=Ob<ήn>{ Gm>׺| `_}W'/+x43Kp=O+Ё۝X3KSjvBo!Sծ튑 fFPH2TKTVrd@WtJh/+1Vb%8 yTGyZZ=^;㑍s@0Mne'xpkIwZJ{>R-}J27eDvm|γj7[email protected]1 }UOvomӤxחiIL -.m4Xz{z}?ͽ66ǔm{юїc+B)9atY/EQb~__'xoxޫz޿$~x~uι]?_ ] J=F_{V7[email protected]z Ǘ3~]}Wg|[뗖_W+z[Auv|OK]ɾ=뜳~ǝOe>+|>kޯN>_>goS尡gozE^|tח96ZD{ǚW|?9/L}/ fQV%t\@Cޮrnf?)gwueb.pI#G·4e/ŲdBќdeh;lX =yCݸuoJw?O_<랾z<ԸO>뿣ڎx~GMu{?)KpWҽgQe4o6n Vg<ޠk~v^SM]u/?Gg>ڼ}cXaV~yjL]l~mWd&>͵N;7nh"z6"~ Iͻ v~SSϺ6'F ly:Atw/a6'F Ғ/z+{Za軵ת;s()HcGް`6}-JuOK̟:|_?BcAdFPO+lƨ&UFarW̃ I}iB-1aE1b (XR$E-)0RhXU?{{oڇ3|j L2E*Pƌ3WlU$ˮ*ř/@}dtRr5Eg'&2+2l2 [8{UmȰaX1h1 L( D [j0 XB.*k l2f*ʬNO P_Y5ʈ|Qe0*pcARj10,*D_wO;]z*泼wuӦϛ=;پLUay;?E@]uB՞^4fӋ(GPH06C̵ @(.\=tRHƀ\3FW5M+)(gΨTgU|8(a X-D)0 DYlH&Rj X'܊\]Wwb"5A̺.H8 X(m 4pE*' j.NlM#WxqSVq|K% g0!X,AQ MB(aD)0.$)0h[9eVκɪE879+H뫝hN j!S|5 2iduR2sQtv1UY,=(FB%Ku(I]Q L0 Z,(** MS91Zфb(@_dىWģ[email protected]v{'?S^Timx:Ӡ=NuOoK^Ŵ:4Gzߠ=$TQ%XV4L+U ŀ,rv=cC p>vN>yF%QQbJ4eK8+`^-CZ*^$wqG}Ez _}].^2 u|Յ Vf!X0 BEX1 MTTsQ0!8͈[5z~\k.m^>y}Ite:a',i\VV_Gm |S;\um HR$fH+d볞MKj~μ`0BƉ ] b꥜T02 nwCW?KL6>qrWZ̃ IT_kC眑ˆ[4ch 0EA>Yh>IQK/N.JH1^z[瑑su~ԏcw/W-OϹ )$}|oBz$ $^[P[.-B啋89P@JTz1MSJ",6z{dUeb̃ .Qdapө /%:9UK8%ֲ,Gʣ,Z0 BPB٠фr_O*|AdiiY,SlLte{zo^]V^M^qϓ_d&-^וx}'WY⶷FnNvoewe|^?Q%ڬ1_cb멤1lbˢ*&~ebS3*3 LjCTg(g틹a8Dєd}9#51Z F`)5QP}';5ulrti.S׽8m/?G/K<y~7]_:;?_wQ{5 Cz}ܛNJɠ*ۇ맥ھ^q\/YX5J#D",d8S L]6Ve}=?|yWz׶| Njs:ƲmٜC-UI`AP@EA BR%,$ b)0${b€bDaWݨf$,Y36xU8Wdvhᦌd958Wϭ)uu|U+H:UhWW=>MrA:z$Ѷm-WnnZ0!EVX1X1 1Z0cI& bVE @d8/px|Bǫ>i^fH1SJ^sկ^=/8|{--9/F.jf[email protected](R@J躣0.Gؔ6DY>I\> QQlLJ5euG9C06BΫbBZ-(h-EZ0h-)0 b"$ׄQyނz!91ukKs> ꤐ!9,Ʈ=TBrD5|3T}Ub˄BqX ]Te x&1jrd&C WVyvH3AAk&WZf%*V+U-aAPa F(1 @RaET e`ږ®]^!yq'Ruǵ F®%|4r˾$"pTL+C-ξj ĥaB59/6\!SV.*2 Tg]+d[+$Ն'5-%tꌳs\}2p֋F`(EaEhb(c&UI[WBl M2&Ѳ39@H\j *7bȉ4^ZrdF.sV,*2 8.ñuif8|VOx}8Y JZ̲MW**wFg7Jy!Hb URj,фhb-&]ήNZ.aF'0si] Th UU L*N#e"qcBK>䢓k]NkQPx*3 )DhΕUfڦ֎]|_뷗n suYFjJ]Qs^2d6G#7qSVhQ "фZ)4Q "фZ,a BD)4cܔ7F'9j}t5A6gp3 7]*U Ϣ% .^.D'-˟kOߔ@dG(K(efQX\Ya`#Adu,T3̹IA֯jZ0 +Ea`(0@ B0(PX&N LQ]?|]9[|V^ TB`jN*U /XD틡sӭoȼA u*2># /ER+WB-lD4e.eYֲ/2ֺSp5q+фQ kUaB٢- ,Z1 DC9Љ` G61|~Yļnx[AD[email protected] H wBxRF;˾?Fѣ)&X.Cy0e ©]OklR%]6ZJ]Qs\3 ͗Z^z#lG5qY- c!H,h-шPZ1 1Йƨ0MÄUN^zU)z~kkWgE0TQ!9x%XTfpz~%*t?;^>$3  \34Okl[%ֲfњYYYg_k3DylUTC I0EaBEVTE@APhFGg4.AX,19>4*,wpY"^,N FąEpŁxWfY$_*V[_ܴ]TpTgt]1s| aA_ugzB .%y3fW QI1^"D0 "EVVBшZ(1 @X1/i#oȾo^x5Fg0RjUd v7YAAf:**&Ѳ8bLWܲ8t& ,%2hTfEh!$]ظf5%Y=:.fWZJL(p)Ych(-AjL-E@E-u0Bx D:׺ UOЀ[&QFLTTHDrsJ G 4IG9atNr|P(*.*[]f9^Tf$,&T.꥗3ɢ8UnnHz sh;*@ETGnnQp=Cz@`{:qS@~[AhN:C\:MaЎ8뎂; q`;l=d?D׻;}Gv~|qo=ez@;#ƀ8 q1FA2xA#fmeu Rr(2B%,da$"Q],d~s64=ezC~CK8J|uA47;GY;VȲ9cEA"/?F Ǚf9Qe:UB~-.VQD$ͫ`LٜԡLȱF6ZR(?Ncb>UӦ!{9',YJ[4pk " GtjV@rNIvZ;ԓ!QpJʪ HG,ʪ "鳑u0F}UMt>jVQpϚu$%_LP_MθpJ5 r:~U`xԡݼM$%0KG}"B nɫ,Jͨk ҩtf`JGG& ZU%bnA"Ax;?QPjyPlJNJB^A.'AX-]|DM {4%z=\%!΀y65>Iun@`Ÿ@LR&A;b]5hъD`5pN5RItFSIjEZZ-y?F!*2AVyh>@>rȥ4 M@:`G)Yvu‰MIr TΣMA-%5M/T9G NHYɇlNJ9%zu$^%g^HɃV+U#qtrծgnzFz!zXMjFN.)TJK:2%vZ~&rJuG-?*!B à[email protected] ;Ita]q:[email protected]?:av&7dtRA))JAD:is=>L M'i+Ydi(1f"R i6dX)OmPljO &ؕQY"JIh*E4{"Z`ua/3 ԣ6JAeJlH@ 6 D!o@䂔|It܎ښ1 J62Edeà;ItsTU rF56_Ŀʱ2JALl_ZCGUAWM:@:GݺDt9Ъ5u,Rrrkt#Xlj^d&Gs*e&NU~$j*"7FFv-IP TѩP`4yښb+UЕ H'05LH;&+ROIF4"e/[email protected]l5BDjO$FUENT7MS&}U \{5A*Y4_ET_H"e'>1R7I(6co@[email protected]<ҥ1VnG5ƽ $: K&#/ ڣI?Z5JMұ#gXIؖ0ԲN p^LN̦H2~RZKHN$=0ce)٥%@z)x# 2R B&@)K <^BƯ0S}d#&*4;9rQDo N>$M42u"i赢a MLwj7;m e&_[email protected]<}tv7bBmsr(YE.,|:inY?pj̥[O31+;Xh];deL2|EA:/n@@>~unnCߣR|R $&#]ZZ)(HUx'2팄<,VAwLd`Ȳo!1),鄢W<<3^RN\BnL'ӎdp$XJ̭ Ydeㆩȕ|DSvq=#2iTs*cj?ҬG R:C:t.MT'":{n7of@>t:I))kx9^=g @lP(3E"21WySdW)RT^I(13ڽG*k&B2|w?'؀~{t@w * U`f^ŨfJ<8oJah&șktUeȄkZ)Qź9a],kJ,=vL~Miu_I&[M m9" nY I@:C>T]kCzCqp\BݺGa4?]q u8ɩ\ 5JEcnr!nۆ:CAߠ>~z;ʨ%+ YhvD<3_;<'QB)Co 7, 1'&q;q?ẇEt\n۰jʩ6AWvmEʒI)X tؤ  nW iȷksH&m;܊8 .V,vAW+Vg-ir-G,޵CrCsw@:{}ÿdxݩ]|çvU4eK3<D2ȫrLbhŻBRXP"B?]=fٻt=eP.Wpę묱ђtX9|Bg/_*2<;h}I d+*3)];WpDtsWA ; VQD# ,Y9~$&R9LFpb;_ɿ:"~YpoP9+RJ>p"ynqkH.syrԣ/~Kwנkuߤ{{F:K5QmȩCĢǪ-H Xiw`BCCQ3V1H9#PǰP""C0bdAtfMNhHcV,(6~TR]DS3`*7nF,f,`Fb NG^{^]{CD4mz7k{gӬ4/)sjQIg/-'M#gQ/m;#㲂w ]s@? 99PO^?R&TO {C^^5ͯͯͮG\rNPDq>G_\|uRI*(<%K w&b 푫df5H&j5^zjJʹbFRC-x3qK fo[H7۟X@8 {\6{C\!T*i"!ιUHU vxo]"y.fKBJ"2U+XYFS ][email protected]dHkN#2t\$#Uz(y:^~aЀt?CɃ˓H& '>":I{o@<>B: \΀u y@} B:~ݮt>tθ׻CPwE W\}DGB` p#r<<àƄ?7G=|qD5Ba#ͮ5tv@<G`;z θayΓT{y\kq6r!w^&5Cn9;6y;!w5ț@)vWp=w7X!L>u t~[g}Kh1vSpnؿ{~$"p=" M?3t2;M˹=GB$GMhe{n*dM,~%dhcۃ-Uw2F"zM#+`̀M (_۔ SI78I`7CmA9d+Iv gPe[CTsQG1I?\RӇ "Ȼ*Ei^t.l@x Eސ]^.vH;rne4R&~7mm᳔3 64 %c =;DEM)(6pLL*":ۦj*voɦUPo|'G&t]94بUCE`訒|&Y"TT5"T}JMsNL <.#kؑ( ;)w#ۨ{}8ϲ2,kWv&`Y"7kmYi,Ed5:q $-wdݸntٻxS;M&J 6+ǰP ZD cZ#AMUA6* S] I5!̗C嘬tq eC}}{n)LqM _D p. m}FIBe:3{M*c{u)%D;tҚ<UP99OKpC;tbNEARntQ#A,4g J?ID_$zR+(GRUM܋ '# eB?|A (W.V 9"砚x]O_i_(~P܊MbзT_jIWԺ[email protected]9)M}@@m5 vSb"F1:?Mۥcv&)Pjŵ+Ub1Gj] WV='kI'l1^=VA,ջYArشh \jQn *q1h˴;:yB:$̤ LzъMtTk.XAԳF$m,{0IGkZԬE$~?+K-*5AahIFL(e!͖]JD0 ?Q b1sKDpz:8n=þGdS1 JɯM̫R =LLcw?MԂ5W@i7͓K;ÕIyE܋FUt *bIC~#z?ޤ?:NIWӌ~H>le_G:MIewK22۔ү_2&Y$fHE)GȘrdH iPEQ~*;E2PײkM+ jLȬ9G "dɜpA0r,cUf&1{#/QzbR}iP4Y?b80ޤh$x'ɭԇb] `'0ѥSIvuQ#F"4S&ҝIGfhlq[6bXm62DuT8~9܊zU1TPɁnG`~JRNc^ۇm&/m}$ҨjEܦOIrL=..A˩AIr˗O&Azó2i@\(eYt͙QOd'\(G3%㓑Ӧ,)Tog2klea,ˢ*YWD*G_|*߮ G3O$ͻʺGHr hA_R JswKԻm)SLb^ۇm& `U(]4C⤉AC; fda~Ήc׌lOXi~X`Rڑf&q)8")ĩbe4m[wgE3N 9 -ԫ6/ߩL $ēdb8Af1G6!LjU q@ a9ߨMzmLB^`(zPH ct])pRc"u43Ft+>TiGpJڀyUf #y&MIJp˓O8pm->0dWi,|i(fR$Q%\0삥DQDVNvEjl^}=DRyc< c_*ɡ[email protected].Ѭ4%G SX Qi=К*)PKGTh;ոv؊ &$ Bp:ې!RtH cv.:c{hCf)M3Qzq6ٻnŦTM6++63ԍ"P20ۆ~MߨݺD~9.f߀7"Q&F!7I{/Rtpe '*A&ъ$7ZWB^ !=Pr.{THHH}{4A:o֯7Ǹw ,tH&p٪G LJ;&W}&a'GK_Cm1/Ohk:Cfqy !NEɞ>$5nFnPxI6~B( >qQ  >, &tĻ+ l=T@9̡ ?P IRDEM"WK!U裠}|s(G*J25th額Wn^fSZ)thVZI7pfg+4[=$#)(eR:*UKH]tE hIT#ޙ-WhL ]8"ҙ D*1stmDC}'@wOrvE#6("ٺ(!VnMF&v)",<`dbjdɢݓ$诅걏<nL>MHjF$f[ni hlvcI$$ "5q4Iϛ*&,iK"QVjl#~8TR8@uVoo&HiN9XN)?36GhAk/ )A#QsVdёH#m-R|4`dd&3Mm{Cof,ͼ|dZL2Z(uzL/Ҟ״qP|4BQ/;K: *GT.`9 .BAE|JD(UTɕۢrRcII .N)=xzP+D13I(`t:w)CtK'$S&L+?h'Q%+,h"TRjT$9tI9$ʢL*"юiyI54. dVEk&pᲅ*I!+# H*$~%\(ITO6J3&#ɛPNH^':&xs};2IVn~a+&h٬{)C5DrƌhA VPYt<RT[ǶhT`5dݪUx'$e67]dq &T?h$wC\mZFG4rpbXɶE,e?Ewb &&*)¬E:vQJyB&3D$lf0xY&RdfũfM\$ E!pѱC"X%Yt:L.AhvN!hݓyA&dGQ<b'̵nMF̟ɿn`* @^Je+Cn2t@7Ӻ+*_>ܮxC ^1 r7i3z+DLg@1 b9r˩ .xܘ2$Y?@ʼtRE듼R])1 J=r].F/#?~M뤒 b]ˇ.$<̑:QU'd[0 NJ"R>*].P)jK 젛:2N5ZrB˿*3 *tK/nvJQ&,ܙꓚM]?YYyS3RC$$T1椎wO]#Ɨ0àAa } r4*$(-к>^B[email protected]Jhɝ>{OD@>b부x?C<&2@ЮLajИ$Oy?(h@ȜrHeJl Ls6ۤ~|o]_|фL=:Lbk1LAR :HxTE^>@vHcBhDGF>0TWL8s  bFS3h5:au&BNs(d[email protected]؊ڢ_h؎8ǵɜ?%=GDc!G{t!=G~d i *E)TPti5 e8h(PCEEC :ȡ׽#Q00ʐ cN* *b`}֧=8@7dlRSUQ2. Iw~rHhK(DE U #]v49̱#}9J?}Q*WI$+}}}uy:V ~GLT0DcہjʚJhdCwOM?#ZF2Zv@XUBg+ڕ̣B!ν\:BiVЪTàm"g(FP0U4P>H U[_y]}5:_q= r {QO_h a3b ă_ { {WB&C{K/p@<(3.)(sɕ NUj"u xUxY&(lcԔ`MC( "*-[~[ $'-h {uN^pD!0EARP  }Ph9(DW= eSH ; Mÿ@lm:x׻^%Z?a[)1,r. ?2LWRmӨM5RF)bV} ɱ4Ӕ]t5 {C^״5 p GMoïPu (V16Ȯ|aUbD;t'6~8!͚oWB/{r:A2G`ۦwaŻ+W+'Af"S~dsW&1"fZ:d$ZFe"&/WQ6/U*Δe a*>&X1X]>DQ( LeLmp0^BQ1vULH~ڳC1]- A!IqTL7YiR5:~[email protected] ʕ%GnAT_ :X pzzȻQ/* 8nM p cPb)`t@9. ?[F)?0d M?MoskDҊI"!9m~B!5]8D1 Dvn@"ܪ!DT&=w)AM \4(PCwЇN\ =ɣáa19T)bG9=tG"L}W]Jcc3( ^6BQ[email protected]ЇCx?$IE5E= ]Jm>)d#Ƅyd ~T9rb!D©GpL"BBv#/usC`45׷\"EIa.&+)a>װ^9V \HQQ*2fGp7'?kGn"M ``D(픚=J͡*e!tem$^];7Xun]NL>uLoVXuUW_u]}tKMmER\D();s: "v`"Q"1LCt"GpKۡS: @ aTuqB Ȧ1Ln]}B;NRk4"&)螈s&>ё0# }E)6(h\kt1kKm60)_>:nt0SHSwL2(pe!п ϡD{jDC9?*Zɏ %(UDt)h"U8@zh}:( >s|1Ѐ%_MK"e .dюsJ%*s{Ͽ!GE1?tOoR0N h"KBre}sA?*z?ѰP|A.ϯZ43@!M1P ;3^ԉXCk׻B< :MA&L 9Mn> (k9 CLbM84BFuq"7$u {z9&?q?vs(btr$:rhG{uP,&) %釷@#6k_tB4B c{aB)P<!}8|` On!a/L #:ïp#Gލ{u|0Xm3Q"hߕ.L""2a8GM79= [email protected][email protected]=B:r$cޚzYSP Lr D{G\p=p: -GET{@. }*_g{Q { }ㆌ9h]=onOoH{a]MP { .iM @QUV҉>0! : )$:BcmEމhnOnl#H '@BB* 6Lep h\,: Scc 2bdKV~P."a9ڒ1 Ah)Jc eCt$a 6׬Cj:ss4*mK$!qЈCr0Gp#oAQ>I0ߕȩ$?[email protected]sl(_hnҖ4=C<|=_PQQ0<'|":RS{TL&HU@GL$>}ADCs8]v8q<@Ǒ8CߢNpt 薪YHlAۇ> :;x6'<qGcAaø#;%pbCe luGn_&: >6b=:<lQ*A >0m;x.<㰏#Ǭty k))サ4̸llأܣ_Rېx4DSɹ:UӠv JAأ@xaw0]n#;G* 1YYXcLTjf^sztDQJgb%؃~ZE(w}ՇQǓlq8;}v8GEM⛢5)/%6Wk3SlCEq;`'iw[w/ AU6bw~w]4kYi 9%Q͞~P4zvOwI=Av{SsNﲛUvW~\+ swdȯr n4Rzҋf ÍX[e5Zqk玵?Go3E@LǺngͷn Zpx6QxIg5(bV׺[email protected];KF[}lIaLXKŗ}R]|MθU}uT_vBfutoHDbڹsuYwztˌɫd[email protected]Wwmw;%v_<4"b9 CKchnE[yŞH6n^+umd{}r@a]4ȴYyXًsq^r*W}xfԤ@jhqL:Ork-y:_[RsFPV9`>bwؽNT_;蝟oSl~a4]ZOCU7>jZc1H>hPz).T/KսGaoAnԽ/SValEomo٫Or9GqS%MVUtT\{+s-,=ƪ*2ڇ̃(*h>_v-ц׷N7YGp E@YƒN^cq=0☸$V{U6A9[email protected]t5P1)Wb] RZ'Aizۏ}X{l>oץ+̂58 Zcþqj/ 5,%aƸw-F+'Ӵ,Qq ) >1ro&͔1RV[gQd \Lݥi^9n,ղJZMz+1񒦒sul- p2ѬE+ GT6 q򨧜Rյɤ핱kk= aU6Pc͚V܂ΊUo}H#dG|yHT%u/FanN\?6/ըع[email protected] æȉs_IrZm'GnF9FJϴ>z;;TVQԬKc="UaIQNȜuU_k]%9|o]NAYAV0vZ[*^z`.];T_+7If.]P [ [+|#j bO)2jjC~aӦw: 'si&1FcqgI;UWוu=y#k^e2)IUPM*+s*uEg$ 9[email protected]HU+cy.a\TɬYLȖ̬ZmCVtCV?#FpŦ-A?͘I!Yp}@U, GDhJrrX#(RUޭV:Z6F~ wؿVҰ $E]8gΛ(;nNg*\Gpv-So~D*2MMb @lݷ76"\l./g5;Ÿ6S͏x`lmݵ6N.!ͩ fsnx䴔 M&tpVZ D2ˢ"GmGUe/eEYh Ɍ>5"Yb?vTn-X&el#Sk-#.Z TQc,8kK׵[ir7Mk9bVuǶF}ZȳuA[[} X7pnڸBi)x鱚g'QtLp)qOadQU :ex !>*̮=ݗOlNl=s;[^Y_&-e䝟2 BlREINY[y.E.-D0ǓNI SYUܼțHw2[ɪJ3:no(qVւDfQAB]+cȞ^ۺ5n֚\mail protected]Pl)d&Ml.pd,u;R|ɊJmail protected]͔I;x-N'MBPXǕ.iu)ejȜ̹ s;ڇ8!yc^#9;2j@_Z+oztQ%U !RU]5QK^@nUrփb}%_iKIb~_@x52X^R\5loa n4ydnߧvJ5?t"1,06-]XnGa.ב xa5Fd}q/0Jl[ oVc 0[3zrqmjr6TcnIҷ'Y(Yx΀n._ Ǿ][-:8wzb4%L=ђN<= CӷU9S$v锤l_"^?} YO9-4XtGlnnH,S:6))vUiپ52ddm7XH؟N'`ۉkF)n;x0ҲUZ'}b}Ola7}EH&Rsn]r[KSm3|~LJ] ɪWyQ"w,iW҈<ˤ3Fy%mg۳|h yM'^;5f>ijq-Wc+Roy%CzӶBD]wcf޹۲~GchmwiCfp]x?%ŧtѿcü%36IQ4*9X r0L"ȬR};E%탰w!ΙݦZ@v؟Ldsqg->h?Ӱ~`FhҙLHoxJ="üt[!kX #wv?lS9Yw7}ýg&?c~LdUZOxېɃrf㽲;i^ؼ{9Xi{ xQuv>O*i[_ VGǦ,en|:[:Jjx5QMT+tH3qU2t͋ۢ;Q3cGFHJa3]<$d 醺?m=;sVyM :sT5BN݋U%ڥ1W/sD/{a.eMQI/<)Vy5+h/ vSTu;XXL* "kbp;Q 8o%álnhLY#H~ʊR*t(?/#%ҭ'\[񧫺[-lyw-țWyhQ=I2\^qD2_,nCctM+Npʨyc_ڋNJIY%W_Ǹd iڈ KK5PXmU3b{t[HjGE]`<) Yl]e}O4N!9`#K)Q=#~@~l;ڸXʖ'wXܟ}mej_\zxck+ u]\_m?bݸq7|dz Msb/@(_X%5 w6e*xVn㡚X{k||zm%k4S7Xj-nǍsc|PުRW.[)ʜ6qǍjƵ)sSyȅrv?eY7e^HcaUbX5e+d"hWw֣ºOQ:VY |.(,e?^_r{5; C}umJaFOE\˽9bh+RW<|eIRl%U?Ʈfxf*OjxIVM0G8~hJA̪Q 6 9.mtxF_5^wwnm//ӱ;lS pQ_ShY'}w>le7?ӡhv7}{lq sDi+J&mň;Iߓ~KfȬXXn4-^1f~}kk y{I fs#* Ohsf>5/%۴{7ɥ+d⠤Z]/ޞd[email protected]`?/v/nm餘#RIZRD e7?Ӱs~aL-ɍJ*7[voǺ5ަ!e @6Gr;SϗHI3EĤ[i=6'Y~wO` lAN}?Np#áMER&Ej>=ZjP'Hr: q4t<4*0>=cFh;vQv7v8z=u:Ou[xg7V4\ !lh r;Zә@TrۣSC~VZ ASxҠ,} 𤃔`GS_C'"5A;;~]t=1yЀln5Ƹ`2 ) r$07e\%_斗(a)>YSyŇٮH]D:QDIZ9zVv]Fno[Pu= zv 754t։;]YD}>jڵV&~Nڱ.504U-BFդ+ c/UPXb%F/:Ʋ2#bkJa^KڊKX̆*.D!slkGw.'̂4eUCV"P45Ssҏcoene@t) ݑbޏ=eE6٦,d4jj@K-9Xģ S93MZu2/l92x9Zɲ(p6O("}Z'N/CO8pmrO㽥sWo6a2x}~Ѱ7 'K%/E`60>Rv.H^Ƽ17s2+%&2YdiJ_[wm}JRtkSu1fhK]eoOPtmn|tu X㝲66݀j՝.8HU@ټXnd!0-lWY ~1POg4%:gypZ8k3&>t' l.[79BeI\ơw[ksrQHۜeǪk(#h;^9m}ace1}6Nkndln049_T-"vr$`]4)^X QS- a|s4`4ԥ>:\pC:0G!LcmAjEw"{8.8R l([email protected]]b%Z')*3~S*e܅<ʪy1eiG9TTVlWյg'JD_+Ob͓Kfare&M6kS2B셷 %UHk}iɉzFlPTaY&,mA|ouY'Lk"d};ٓTQW,2L8+^R= HjQU|,nVe),TbGWջ2,e(br^9ʪŪNpv&2>|[email protected]\_EsO-`oѴlfXe4%ʢ30m^rjj޺+gQd[!VmrV5mm^scjTg*yT¡P0V!@6 Fh?ڝX"/Lꞵ9@:'w9 xc[cGpVMn>.N\{:1aW؟vFS,n{ZM9Rx̲55&;62,4jæ[+ie ~9!J?{amtM 5 @GζUuLí6SZq *ʒ{RaE9xY"ԍqFhYua4,͕1E#T?k9_Rkp~ֶ` df$#sR~&:^e~5-;RX99pJJوSVŜ/NQ,j\#8reh3y2Y5h-U%CQw/#~6֣ŭڬf;=f">6"cw_=wȶ:ڋ'{1] oeP4 ٔ,;'jbTr%ݵrmUI86 @4ESx۰<-?*-H7w r;8-34HY*HRԈMLR#@8[ۅ\ZzϐW=yMOjqS6wFB+l`ɾiNNzzGʖs$zz\H'kɣ5깖6b<$46# 2&{[gX\Kl\Ni"yIe's-Y:ȶ\ԓS/r"}!2R&QޛPu -Ul"7JU!dȫ[K 5/lҷ T?KN >[email protected]PwE ƗbO83ṃpCCװ5u5Cڵu9_Ed$sK~[Q'Ud\ɼ״!LsGU#?AAC A 5JC=PT3 T3Ql"`4 8 E<,TGu.~4S hVv7tPV#=Wπm$zlÈ+/<}Rn46^dWI84gTGAkuYN0o졧5#GN6ءPDQOF=PTP^DAJc((LjCCG 9 r7B]oir:K-mS/F>'EѴ[CYlV%޺5|䣊/@ #ӑrod"davYX; n3٩z6M#QA$)x 4IEGsgFI"UbGjZY{و02`qx p=:Y3ϰ GA4pD9 r8 \n (Aaޜ`фE%Nү')Sdhz7]MMh(rڒ\([email protected]6'ִQz'`@ءȏS$ V?80GLڹz#!iKNHͨ9 8c!1}%nnaz^fuQű*w?RSʾޣ`h[email protected]̙DoNDozTRUVċZ*vPbZ{mՔExjȍ{2Pyg_+{eh՝-Aq8Nד7rZe\k㦜TOV#8q@@U[&O6z[khr+y^=L) fn^>\ tko1/#ګ1v^O{yUM~v]ˍh܎qj,ŵ}߳ q5\k)IdJPsRQI,Rۺ1L}gPMuq*ā̼]{urg$vM\bE-_zdMԩQ6(p9C9^` ~>iU@ Cc`t;rJL76tD@5`ic-x)O?)޽|Ras%W_)%Ys2_*XoVȊn*,v䍫ʼ~=1R/&[ 41k+s~\kq9̭TzYYJ ,ݘ$[email protected]RUM*&8[email protected]7 [email protected]"AP)uEP9)O;lB8 98 A{` b8z(r: 8Bqc!0rc;\̞=䒩q"ˌlP sPq#+)xvۃ9Iii{ih쩱o}ܾ5a{!mL~/bINzzLlⓛ[͂+z>:dn. IEs0'(;Fc>GjƔƬ᭯UcqΚ1vlc~DVAҙq;s\'a#UH[email protected]=5 }!pVm#JvCr#5W[? pδ~f 1 pr:3 D9  Co7BRx3lÚKxDn$^<y r:/^=śif2"-EɌ<5Ke&;l2xKM|m)U6SM(m^ĩUf&Do؛Pqk22Ɇ+dbc,n%tRkyȋ%noYF[email protected]jM:>R^r* 6c]5}v)uoSm:?E/7 _F>w"lPw lP5(r: r: CO,s4tGi8ea}p&Cs1xtb^:LN5]}{^װ^װu { )?a6 %%f6#MGɰHBHn#.0q#QQµK@.vY š#EGQ\=$hF6MCL\zP_쫓FןșGk9y8h0p;8@@t!b%J!Ƹ!Q ]$[AAgP7(c'YOSModn=A:0p:v0r0rQH@CC 4 !8\Vajr'*[咊@4Y~1f54ƿf!c O&` EԆ==t`:ӏ iMG["mEh::N閏m@#YʦBiP6) Ocܑq p/fidLEhh4;tt/=f'O@t !:rp[dD3׺۰:F*.2|%oYo^kWRJ_+-4f" +1? ܚEv(ɨA:i1)Ǵ ۷QekRn6@r3x9йu)! b \=pSLQqU du ޏ_#HR2q#C8Ccc ^`w1x1y[email protected] !%)UZ)~UƬ[upw6/:.Jam d#O:PAk CyY[email protected]=Q7lڡHGH'ohEDJP/AKBRrњ5!v A a ]҇nvzlBUR+FbiUU]P 8 TUc!89vC^sъ!Ƹ@B]v:6B]iaԓ$){f@չ3|s!G_o^״ڧٶ#^;tGmDQ ރ *uOa^5pT+% j:v<ߍSQTfܤ][email protected]nRmBAzAv˰bMVGҎou.`*'KG]>P4[email protected]uLEH>#D8h4!hv߾^: PvC\n% 4Hb3؟SGtRlܥ=8MڮrP TTLϯGGR[email protected]: ^6@8$L]< U@{XU̍C9- C0FKp4!cc^: ^z9t:uqJVVu?ߠ)`v"P{G\ji=1V·ڜZ}S˩53=P"(-8[email protected]:k@46X=EfjR~Am2|cT #6VN -Te"k k/xnEs~R1΄ Ս1 lP;AQEKЇ80p:^F/G}:mPBHK59RK*q:8)^TLԅI(9[Pr@%(L3u{uPiFpQLb g#6.:b=PSgJD$(/:Rr,$ߜh* mDm5V:!?zÊNx)$z؅؁"#+)8ZCaC9n1x191817@BM5`xTF0>-]E?հF8hkhk|΁\|6秊r{LQt%XN:J^5LRQ ~G4IQ-+7-]TȓE/;,]ɼz)rsvڝ)y9lP؁hTT8FL80r1y s/!p=`w1y19@Cn: I~Ki۷O܉BQ1KrI[zC8rrMr5Ƹq5ƫuDt}e$٤(͔]v&ЗV JGЭ4YAov\{[email protected]r^GbL.( ҙ6/@99l?CKJ4br!˱CЀAn5A%j:Q W>C@2tc=l2EI*0tą@v0`f噤po5e?LA_՗@uDz޻~K5ajjGRrORs)yإ]G1[email protected]?EIh^ lb3H8@8 AG+*i#4C_hCc˰C9J!"֏#5ѤD-@ia%5rw!! ]:f3Odgƈb2QՔؽa(Z]e@PLq Z$Syrg!rHb!#):e堗 #rDj=sʽ 356hB4P؁ԙA 08"a@C5F/l!΄4 (@BQj>^F-#l<*ץ?:$ F8E CPlu6EKH?V.6H1M=aG >p(hJ6.]:tΤ,GE \:cIC/-Iλt"  SjadG I) Ρ&[email protected]^[email protected]99cIhv74;lZ+FR)TeV#o)JZc]S1qM+?EQu;pUjz2U@Z;qvu;J\F_/7#FP40+nu4ڴKop s`ZqiS3Q܆12bd8dw֖B׷ 6*kS2Y?/WrZ|tzxÙ'|,vv[^+3Ǖi\f+~*޻n3$e#>ȶXJn\z82Z*>rzZV֗v՗,1kEmsfu%ad^\,tdȯֲ]Xx Ɍ@Խ!!V w/G9湻Yn¸rZZ)1^bCŽ^W/>Ac8^!Ŏ$!.X|ђx챩﷓lļTs-.s+Gd/,W.Z2V [uHT~*frgFG/"uUR$]| H2Rijo^Fry Sfi,r.+voݓKh-ĻV~H݋V[O0?qߋ2WKV"ދ )˹MxZ>*0*.a,XzxJ^&p\+!qʱ93:?NwQP{l݃ctҷ^>WEA\wx|{t*xb).߉8\/<;j͟\`ڼ G3)0>ߎ6r1> 6}KsV^]wRmxFYEyc5k/uK;q7yb$$nGs6mAYLY~ػKalKP8sֲOΦ9_;Py~̛͜WxGFI-்? YY_bնH.&$εJfeKx`g1rK 1z:r ~ybl Er"nvW> QYuڣ&kv?"6-޾u==vFax|;+oJFf0J |lC5ȼu9BlE)h1/1XeC/CyRKwri#o_Eѳz2 x1A)ȏ$/H|r @2jJe/EŤ3qR~&)Rc"ĥ mYĶ7W5v ;u=jY'vqõxoƹEe;xy\K/hF=c*&3]ĻRc_XL~^<0vʫY?EdT!reWo. ZЙUر|O yy&|vݬŏ.;y<<׃2+rsdžЕ]継;`au_;2yGixk5:'r r]o!8}\[.O 㲴̬GۋWW5MX~#91ib݌.쿺8~Px|kٍG4Brx6G1mWSv= i oI8IGR._beul}{e/eG`~oWXPYr"DYv-WqZaé<ī5Pe V)qo+L2i-V͓ hEVY tiWF٨?Ťc#~uBIbv"ټ4?0 @_?s>R0\ (*}~[KJտ0;2[email protected]Դk\ƬNy^Z%lelg|@}{p*Z'y⍕|k77rM9Aԣz-{KNTe= ]-^:T9ԌMq{oΣȬ}l|d27Vַ?\}jۛO|7{cvGf.1^㡵˸mwJky=\~-Vжv:؋coէ:9g9TeU>\w2Xż(ƌd)_Tֺ0U^Ls ?ՍӽMdF]c# ky9귰qY^?2>]Lږ!TeicoI ƚڭQ3RV ƌ@𤬏* *^]G"#2.eߕSV.Ω!>mRPYCZd7et9_Zȯii5r/ٽYؾ^L v:V7~bƻ0?ȆI<;,:8͏c#mGTTEˬ?76^!!b 2mF]V<]Xr24a'p8leQ]\GW:L l #IR{;{|*j\kJXOGVH`[5f={o,#-֖qmؤVR!& 0#S.4-;7&c^cfO_̅\ʸoU$ǯ'KDw;t؏ 'Wyi{36G#|h+ە;i?/Y7H_#~C, y^GPC_!2M-A^/vwܫ_J30Qş<k\>D.uwL^My{j&*eWe-I߿)fO >@sg$e&. \` )&A#Iy ia]x< nxw{i1K!ޯ,!4^W|$Rޏ-ݻ)NAu͌sfq+..u-s2T&1^\9uuCn%A_l\E+q%|,I# K_fK![k?VC?Xٮ^K62WŶm>b: V?*i8;D Tgctg+~l b>ܞ0|lņ#$0ecJ> -Yx2f,%WyraL W.nڼ~2jTl,.חi[ww`+?tN<,O⾸?6"Xٴe!E!ᕹ+5(g ' OÅQ7S!|OyʐX%#|kTߒKww|-WO5ӐǞ$|'4t]+O~^ c\7V{*~YԞS6)g KyM[&F؈zz9&" H>1\ 3+U\b+LKo?v|c%ůn=]xu<%g.kOy(gzo0-^_ rak_bukm._5ŋkq;ƅ|7̃gʅ9X#P^uRiW=۩{m2Q^ݫwsBx Ɯwfm7!O^#;oEy‹9~G!,V7Sh3 ` 엮rR(8-GZ+H[yqe9S3s7[+6J8^[Uah{̼Y҇n57fpkqޠ:[Z&`CzO/\ø3r^}91Xuyoܗ jxe2~cN#~.%y z' 4F+SAs:1cv4M!algOc\|e~O1jC{pmv);xόiDybɏfH܏"a+{?Og>pׁOPzcji[v\E >6鏜? ΚHCq7^h 5jOk[email protected]zOoӳjɌ(T=7H>;j I/ƕC+PFO %#FcN4PIin4 q p|@)pPA̍\-H#]TӸ҄n Is*P 񺠥HXW~G3!5a]V0 n_(GpIe*N#е +BjqBhk]ªJTTZBl-i٨vF]\Ep&kWڈY㣬|J07dn@;}7ÿށ}c Iƞ^C#wJ:cNbUn Z{5ou\XȒnRH#*F7_zc̫^7HQupʍeT£' '悕V C(j]ZN;&ү/ {GIsY=;WWqb)k? ,H HԸ),2t*ƆRV#rUYv kE'tN),XHq[email protected]Tl.AR'iPӰm^!yT?ͱG~y&CrJJkhND$o [email protected](@%@#QxQjhbM1TZ)HqT#([p'(;ZGD#fՎ]kWj]G_7Sy|<<]R鮨z,&P.QN]yTBN3,zr]+ӈFRsE'`n]֣WLRwtZkH>bf:&Se?:H#nH 7ԃLxq6|`yryr;na6)Mt\Ig74ync+6F+ĭq_%M÷KecGFLV*F]t~SYy`Z VR<-m&@f8rkfSBhxv63<ʁ*@6ʢXI4*Bf *$; Eȸʖ[(`foBA .;@W7*y `Z"LY&FZD~&Hk72F*֐h˳);~E5wI[__g(.[J}u;~3?M2W.YX2D"D" *R 5>4]Bxt["QAw~uѱ28_9I< '$tPTbi`uԠFJ  TU^I|HHXXSuWԔUZQBhJd͑DMH2W"Hg ٛ2JaD^&DG!RՅ$#m, rFF&rJ[email protected] 'C;EpG$hR7p~v[M4::l9, RѼ;V[d _Ϣ^*|D!-+K;jݽj]W_ΤqgiBUcUV;{פF$"Iu.udvR4'].,ǦK!"DS(rWr& q\G+ײЮܞ:Ǜ#2~iHtF1c˽R*+ Vrkc$@$)aK* aXc"Q^dLܗ[<$,[]/W"t=%Veq"1EUfVf *Ū]:G9.»ⵈ㮢e2b ͕, cq#B:JI,ұ }R,cpZ#̖CA 9G P^YWUP.k IXC3diұ% !-Vj0,M<@? ?[email protected]*2YPseN$ \{[R U z̺ˍK2iTp ӆF ^fPʵbXȱ?-PT]N,̈9F2ex ½Pkjmu/$y뭏_gk}^~nkc\}mm#6D@T74$6\h쎲ZwvJx[ з $1)TXjʴN xEkˢ(k(<7A׎.2S9h5I$/cUFV  |E<(z`Ѓ 8`QB-OETfL(Uwp|l *[qnuL 7YSc$:`᜙-/H0VkD- VԢmR|#sSxg^*Gqb=GO7`F2v5)KIG`|Α%X4O]mܬhי@k|T/z rqv+xV879bcx%B9A܊&*ʥ)AJR Sjpǃ&<qK6&>*$$I U(x$ 9scddI*+bƄ^lbԡ БhڄjV4i)q kEu + >>."ʪC`n@G MA,7ѡ(Rcs9i}}Wak~>>4dvUs)#T""nRR ڼ`3 4 [wZ)Q$V$ررܑu`YD)b? 5>CtDk-nu4RbHwh`aC/@HZT@-N A< 3GmE8H oIJTJ=~f[1/˹jO%GA[p:}m,٦ux **v㮩 ϐ Ɩ6ȏH̕1xle; J]B$xr2Ƭ *ڠ+Uj cf~&p,c`6ioDhj,oRË%*naERKe xIGQϟLlfI(^r RW65Q]fɕ-@(+*;N:qFr#附_E jIL+t(JlIT dOi*T)!aYҭE[Z5ZXGseYFK[email protected], ǃHDaR+a.@Ѯf_DƸ?3x@HH8E ŘHC/C.`ċ[149&r0EepM=8'NTA2&cEBTRκYM:dˉVϴTx1 K**u֙i&ED¡T .S>dN d3*C9Tm"L仦K D"?@T*R0ky5G Vy!|[email protected]xdEMc.V*EJJ @"9QqP ω56_DRM* 2\nu tlя ]GcHDT6UT hFIEʫlSpw5#ȗ"ci% BM "1(7Rpu9buU3 Nk)3_ *d,‡!\–1q%.X([X1u%En8 ,bwb1o^cYbUb3m|B*A;8/(X*Q2#q?A`U  ʲ J1KpO6D#>,͒~HbhEeroP cuN:tiV1@En xA pٿ2`82sU 4 ڕpu!B#sD-`CJN9OdAR/ 75I!JiC52py+!Y c(jM/"-j`,iS6Z&}[mí^w z yj5QkcXPڤӆ2E#TvPtEu&ˈ>4Uzpk⻼7 ,~>N5̈nqU[email protected] [zm~Q79G2[J]cA Ռɝ%BiTE7s5;[bi]` ltNb¥c)g^J&HbGWv,rxMð4nobW~ cdEHY1̔e b(jj{iZi&e+ȗ.qMlUؑtxGPe ܰnR<"#G.hd $;pYnEP؃Nh 5([EP(رZI{MZеܚlPPmµ\V2JSē'(b4M+)r 78QG$t7)؊Њ{A|@ϐc.n`I) 2ђu܆i"JHxRٞŔ0cIlALP@5LXUKI$J$vAPA|fi;HB^JG[?~lZSKqsGmfh 7M~a EnRd0ljg"IBK(SAMc͏ #1A,$p3/.`T֢$)S#L¬W 5Abr8(X wC*2K^PAtw mWr0ǡga X&x3wm+2$wrR1Dn'$GQF^ #Za2Ҭѭh(G.($P *Mq:|:O_M½"##Y_sbњV]Y HF4,6ƚE1<`4AHA, ծxm"wX[d:d%d" gj;F5yHQ_'*D"c87pBU[ 52g+$pd8TAzHPH4gc4s1E ȱ#fSMw7L1+W,^9apݟ+&)@^kڣJ&;OHMnVu<Z"c∡M:93SɈ2E4|Ǔw$D[HRbljFs/6b$cά@ Ԗ"`#Wܰ k'QN\bN PPR&)@0Jd/`Cߛv[̤G{ڴ9%WL")բWPQf,A]ܢs$1>(+rrPm0RI͊,KF,\+Ek jʌgt,C5\݈R@BI'R w.V y(nfxT=#>MV"_E߿E etB(z: Ph~IT^{Nr$rvAPIHܨ&q㾱+7*x"DvKV7PhQɿaV4gh)#%9moFhwbM;dPRYLhueR${P8M2:9F6Q4f&ɒW%܂ğRUʊ;k\qqg'1خō՘T3Rjw$)n*jNeM|WmQANאַȼ@/Rd܏,X/64)^YXчHU S t0АA '5vzkMχX`(yEZD X J6+MK2fFeH#sPYIRMdž5Z9jW@nĂ Oԑ ڌ )[Ʀ(_R (@$`hEWթɊ eH!ftt~_0 b@izde_P$ff UpﮞgeM*:G0F F#Pb 0VNN8EUxT:Ҁ#JYk6NqxL'Wb, 1,XpPɉɒR( -PMI޽}G>oתz%4}F(/cEfP-d,{р͍UIєEcR+o͹ :Yȏ,lcVGS`82%[email protected]-Գ933cK#!PVbIa0[Gy]u!juH|R QqlIr"6Z % »1>N-]2F[&GUޘ4lPZ1 TrJ8ѓ,B]2NPFL&hq"ʗ<C h5F/Q i U@%*Hj궰ƣab!+29l\ mT&"^l|Y $|j$KLʏ*ZS13 вP~4FQRJ)DQƆbm(X?LlM~CdV#[email protected]IoFh>&|Y.N$%m~hȷ}99f+}M>D䴨dnο̱mcir#ƉV٨,* N0,fI3!%&eVjG+_|mj:w,bdr"Eu`TѨEµނQ:'v-#aDUe* [UI7tȉR I(2,W/3n,RP3$ /RTʮhwTSop͞ a FKCTI[email protected]TЄ7&l:_(w21]ޖ0@aulq Ӑ@j܁Xiu;1A,ljY3٫g1/;DV=a eA j/{ICᥕr(4,vfI#raID!ުx og2j̤HIA^MnsqANPڅ8]@Mk?C.,LH`WnU;'#?&$hjJܹdeKrIHdxie” ~5"X Thʆ>4u#M @%'-2yF+ta_D j*mz7OIe0̲FI[(phGЧkgQ3fnfP]P[email protected]gd$mГ,^F$*!ڨ,ԜUN1a6baV4 WRqS~H|p ϋsScsE.ъ2$h%!XP- ZhA*RMK$WY8#6BG0 ҠP}10`ʑTuk3#*lDF/)BUbHSeRdy h  qI՟ٿG=ߎۭ=eGzT<|4z":XbJa`ʼnA/b V;]@.[email protected]X}2/&Lk!gRyj O^tKЭxҢH>̬xD2obmNzG(U682)SR6;P%4prɬA%/3Ġ)2*X ފVލ/6#6s/YEmA|?ELeXoWG0Rn|.bR8qxbxHakw*;0d:5E˽[T7|5S]FLN9M3+E*rR(Jq$ЍuQg/~NiK̶yWu5zmҥK``1 JZֻ1 W{(7:n~:[=7@;>lv ;;t n.C㺬 RYjwPH0HS'XnyV)V% h| 4r]e$4`Z9mCZq6 Ɩ "-̪\5F_,V H]w5 ,)[WdV6o塑m*]1 wE"ءtcI0%J\yBHU{pPlp2d XxU*Jj zaIL^:0>s_20n -.QRvVC,#~Zadw -~ex"y,8.BƗ2 feP]I3q,asQRC,tKgi WXQwNKXB#$!(襔 y8i+. g?鱮K)2:V\Y,iYo)+G Ku9ϐBzȩ̣~喲UÔ`"IђW e(u)$&P1#3C(E>9X(Z5X̪JBM\ 񤐟YUeFn &\+ve5hR9^6e!p•`rOhʠslCP|T5"H򪩍d0Pl_ ?edeN3Ѭb&I4h112&U9@)T/"iy*j)r&IcMҨ5PI?,}?|Xa[p2/wY]O/fpUUT*]/TGx6eZĭjb5 Oѧ92#ZB)ђH ]/!ghQiVRPF!jYs~\$CUeBP,YknaϏe Fĭc")"=9v4QPM85>Wҟgݭ23B\0э |Z뎾#e5(*([email protected]I k5kEiԊn\SFBݘ2*ѦYN‚@NҠls5! D @TTqT>^<7gF R)5ڟϏ͛ IEeQ -fbda$36 Qȓ3㼣 Q۸1wVŗ b)@ z OaoE\| Y"iIXya Ҧ5ȲHy`vYe[email protected]U z"c`Du5ɼ9ҖXT`%Isgcb[Y[g N[email protected]һY] NR9e&̴.:"Def{3,;`€԰ysNK$1&tDSuOw}u?N/X!P\M31ZIn-hCG%77X"|>SE:0շ >p#SCKΙꤑI%w@5vZ7gLeG: zڱ"Uk*ASHXIiZB_BTXbH61hu4lGC$)PB"YhXD82'S#&$MR1օRH8#$fTu 0UʑPTۊC͇|nSдsG%b Uq܁q"28eb7Ȧ3 4P-SQprU{{'WSZjeǍ0e;;OP)Y.)! XFeEdI#CBя9SRJF*EOX3͒eEpo 4\֖$%*"Fqy$QԻyĪ&% *<_ź#d&hɎy*B:%IUg*)@$\$VV5V=\i3-"΅]L R!u:0Rhb2He#Y؅Tm j)1Dy4CJ* ՊYegc6dER8KQ.uYHIbȬ4$$þ,FNĎ]C\]؅Q[tőRt7[TQaZP\Ҳ!j[|9jPu,y HJSส jMuQ$ $B%[E1]=Mt2vzJ 1(EdQX8@sT 77tAUH59N W ;NۍƖh E ; R PKZTPu1!] *BAвXd CHP3@Vt*R $k褣7V9T0PƲ*bjқI ÕʌC!pKT(]a|$ZASB+(U @S}~ת>C6o)Ǜ^wh2*1A <#y6&魙2/29eˌ!1G*z$@jH*h;%C?&# t{D,W92R9X- Bi'V|;#qB+*Pȡw y5C[email protected]Ҭ*9,yiR:ӞD|Q+O"n.Tqu£MF"6gK):64u]ʃhC#PXݒ;l]sڠu90I:SB̮žMMYz?LXd %&1V7@E*_! FYcU]aٝ#!2+̓-lZ|JM7EƁ鼱":V 3q!Mj 6Xi)!-U?$ K}u[$tԎ'%iWBI%mhudŁ'LxL"Z[(T?I>W>TU3 ;K[-u k7$dE>yH%䪥$*5+I4ch| d]X7w=#_m(}ksKq̋^l"+OKcq F.I,^-&,2 [email protected]%WI/Qs[email protected](kAfWDV&k̍  ⵮1!yt`vKId nda];gC:)1&ۮ3&H Ƞdd[-jv5"%d CP~`h~ݡJД AGBn~u&6>t2d"(rr;FQh9#fK{ v#&9`5#SM 6;48F &UdFebXJ{驺N\wÏI١UVCVH՘ygw79#b`@*[U Nm>y6rֱS 7 v.1*I$jH wG\+7ȋF+p%H`Mxir0cZ20e4Щ#c ѫVv ;,qTPP66-WTgoimi }й٭ڪMXӂvC" eueIYPuQ‰"Y cȯ+G'ƋH阹rF!ǹMJ5h«RREFǞLYHm吏 #mkYHVIL[(+cZF"QI*032e6许OB"%1Q *qJ-hÿ]xE9yPC+j"35*(MF$2C"̴ [5pQ,DM*ۙh@[BXO"9PHq&856 VtΓ~X1к*ǚdjA+$wh=gToʽÆQ?ړuDTf>$MU6Rjk {uQjuSQПou;8ꝿ@ӰOYxKVc (+Kl+^QD m&r2Zլf*8 :+ AuRGsUHrrl4PIHڤ{uS 'HFw@0NCS~_C׋|:= q B`YKmdi[֚cgko H HI#Kŝ43:JPكꑹsP6SnB/e*kB*k[!_"(ܣ @[X5S:71'IԉʻokKVڋij'?kw;F{=TW>3BlZDo ךYE3U#7ږ x}b#T06[P iM߿|<;-m6ֻyMsI`J*j6߆|yHUYHe#PG>f\cDКO H}GqĆZc iu|$ӁC&3.+[ե5Tl3EPI4&pC ] N Њ+Ƃ[` ieHH>Gao&>D͐#& X@j]|8r%I1Bnj&_23:F[-A!EH&z{5,0Gx"g'LI1 ^X V/iRMv"kq%kB\8FL# Giو%!ewi3C>4RFy6Rʤ^5ZuRcʀʖ|ud%ұVuײry"Fe~Z JF\ ښnձa(_!&(Ⱥq$Ժq% y凣7Q`]$ VC$^rLbw :,E*.K9t 'ɉQPZ'Yee/X8eEysP4+$TZ"EX^8\$k~X R$aF Mz Lʫq&  ࢦl*uDBAtDk!!ԨMpb)>0s( c")ٝAWbMJkmMuz~7Q00-+$dWĂMuޭrF.2D ud㊚PEe0t^"E xǰI[>r\v ̼ؒ  +EdS!noڒmo (C̐g,sbfrѥ˖1qLrĂGŎw ĎGVv8Bn5d,z2Ŝh;ŏN1[nV *vP)Fm_Q.y:VPVwڒ("K,c{^iLY=N#4u 3HPH bI?'y#ȫ+De3(, ZRXǬ"7 *wlwF32^F5V-#;lօ:XW%hJpwABUCYeb=o/5YaB񮰙Sfϝ$N+:l$5R˩@?˕J6F`,[email protected]Wt2!XYrM4o[- խQJ]Ȗ< G^Q|L@ ]I$ҿHd%ŧ(y+ FI4"nWs&Wv<ѝZf;R*LW91y.S bG)-1!i̮Ӥb`Ȑ+2B]ylΊBQK2*HʐC.cĐJ*}~<5+>zY$ rbXp8wŏF T/yx87X',KT S~Im7oTu2"Y>0 5u,dB *ƁXhJ;K>gNYF` j`Hnt-ұBҌbK[QhU`0!|ȬME Kȅ,ր.cJS ԙ OM;Tӎy0gwVbQIfJbHݒwZ R|~INVHS\ PWP ةqb[[BGy\i`=)m~r0c UEh LI;FqJ; nգASREkʊ)jqQִ5AFVJƢVƒbSQjhø(;QFaAF5; 9 Ak1mŭ$VNdIEo}M aDbu(g7n55aL0bh4XT|,OG)4EֶM7HYHE^nz6j|GsSQF)HbBo}59"2h @5󋏏2j8pn)MMqCMIEj55z뙉1⒄U#E4jTUT C %.Z*] zi`F"J1PY %IRFƔ<ٰ |ĥR(\)C/%e=>K/c=.AZր嶆*6SHa)V ) 0[ /]mE, ֱwbW7Vv4B IWuPKƓ%#ZU66PSA8!!J@/ mM>>D &; e w =R'Je V [hBңjX:n:(ualh(-VS ڂˆEފhE(o:^2Z-jA sߧtU EqkE0فƣP1ƥP*iUSJ Ast%>xљwŁ#};9Xo+}۵i,JV0d+G4'Qf<,b;4f(+R)գ]xXI/)ƅ mwQ m[FGZH1EPEThvU^݀|hGR}`+4X % %O$Jbq1`KZE.$M*I$9x1Wb:!;E  uӤ O-QH*ГJf>Lq$(Lr2KVڂmk^C#c6s qܐb ^ Qj}M YZԍdtUZEE!z8 1H(B!KBl5l$F2YiV(:2eK H'] =Z|0嫺(Hy\j*: jn2K*|LA+Ea%YLj6Hp G.lLZXlfWE,HȎr%iuw## ۙVdE6(ijuFCJVEU+_MZOxDӦ?1D' eH*ȻCC$<l"I+FcDED7[X. O4LYVrF"+.m |J[aJYRIPeh3ljQ6r<4\3ra#9ގK[email protected]$YSu$0E0. ȎdxIm@td3`CFܴE,v6 l-"B2$:=mtޱԱ L5AD$kH0=SX]+#Lf -3Ոk V {XGI>4< 3GW{50:#y0e VP\sU;:fSl|v–V#rYhdVž[email protected]..f$H j3 +PH{nb|!69B7NyiV":2̥d6Y&LS+I4 ڏ sTF>>2WX}gg [&8VU5\I$Q>;+(%e$vIZV/a8&lHel;HifŘU@TIRRs7T* K9gpF$OB m=Aqi3i\nPhm.kMs WI._ ($%.HiMz >Ds$xDǏ[email protected]R8UMAuN R1CW2J= _ż3zl <$G0N/@J١68S?B^X+xX2] G,qUMKP8Ra,P!s9v[Ӓ\k}c=ay6FQ KՃ2Џ]v<dڈ9)!3ʹl#+ɉgO\" !F8 خ_]wr[email protected]K"mEE# /EhEVy?6Wx/xe 2W֤)ROE4ѶT!)} a+umښ7֦Ͼ,0o-.qw`EKb[email protected] .4 X"5"`€*6LkFb+nA*)9 x8ԳUՍoH즤ؼ -,yMJ[email protected]PM*k<&jI72[X}{r>M&1Q42-mWJ8J.hr3X/6SV1Z 1RjwbbGf: Tً6I݉<{h6^=N 0RiPKZ)@B|==-y%,S$ff@B<BIlwc+3 ~8<Fc$( W>5`Ʀ =JՍ̲p҂w"R_-xB:XZj Zhqf+ pD' ԝ :K$Hd4fP$HI* HNL]4 Z3R-, #pGoND7OHj‹(nA"SC4oJ[mZ]>8Iyc[email protected]H( ($V(#*Ɇ)tBdYlS'5 4Ji3*MjfXX1xR@IVSV7]WMHLD9咦˚[email protected]E(E hw$[YJ ZWF~IQ5T3P!jd|ܮ/.+bZ Ifܒw,Ol)9XBܥ7UI;ltox; *Hq+La x-!U N ZaZI ^[OК)Pk `ۂɿݦ;7-ĉVi [email protected] jF|kb*Mqz!F-cMw'mHb1D. x Gjk6+bęv>][<`A Jm̊V,2UH#FfB(oݚyÙIVP䍉#OqXs2JP~Y`iBP҂ vI ~8LJX.fj!nݜpDqܓ(,[Z2sA J>Evِg9\ՍIQB A>".$NX6妒nUpAeeaЫ jZ YDZ[JISi%VC)R9V $\bkujj,\3,T4eVy%w*R]ݝ0 Ĩ3#+fps [email protected]P|FAR^74(5DJnsF)b  4Qz$"E v"";FMUti|N.hX->#物̖(`{ .zwىynͺ]ZvRj\ey/,Kiu2^/kjNjO;LqAy #=nh,cMJ*:14*;X-Đ$M8B!l(hIƼNF$lY.-I;~uးOP$$ I{%sh补nڥ@EPX HksۏZ#n\{IWup_:i#:qXzխj ZxZ9"I/L#7ZrSS#zè pC5rǂMj L>ɞ<.rRi4 hAU'K,d=ݦB/(;I:yW4׋e5O-Wc5Ilu>m]%^:mT+t(j>[zJ:'#!c.Ȍ֎-h&iAn/Rb2KB-tqr8~c'*(2ʃ`i,2W~t'YqKL]R lK$UCk3ᡗ7HxcIK@ qQQ\LcƉ$Rōi.Bؐu7TX̠*أkBO M6QKg8֒Ddڢi>1+#]eqo Q:~,kyYYNrA"a`d% R?\c&B?OĘ[iCJZGh7(bH[`ntNuAϡGBO} R(r寄::v[j#o']Hނ_*'uJMEiZi1B2K͍ ;WZ5ڼ[YSUދHێH }ܝ#cvׇt=u\yx|G\u\F5k|'_ 03sGov܍pf: RL>wU# ~nДbg5 խ7rrC"G7LQ4i9]vHJ{U-s MZ8œX\^mfVR|Vkao"12J)5EO&\vh^{$KhjO, kegY 9hƈζșNcrUr1 ZFĈv Il@j"QA[y5&9U Z1%Bq ES/KذnTòoT꿫O7efo' qUh<+#'V4oM?ǺbEyU,wښһޅO,̷g"J,%:ZQ2c?Y37,uBCvRj ޗ0(Ȳӈ)2,v-~¥buz{' %XѓnZI~Ū+T lk[!W h2+&9*fSU$nVXCLHP^43HbDFe$lL~DXY#̊O ȡ˚*W' nJI$AJ aWҕK7N1!9b"+wT\YX&c$ȭad p&VRiia2I($xftFxJWÉ<=LsѤ(@Hg)E IlޛD/X2%ʯ{77a\MfE, 'Tq@#d*mֿ#Z+Q1/I%gl,+!*#deB\]MtLfƦD=_.|un06[zRˎ̅yIfnԃǶje:moy姛m:vy}_؟5ʪ.gv4TE1u&$%e1#-|o*ZcZo3a>VD(VJ #)Y$@$dRa߶@aq-~t}B;4u]S%B^` wGs9Tz[+u)Ѓ9[W\ܨႴQjx ]2 y*Xf>zu3%PY ` ( ]Y2`DGYV  4&k4gJF]Cqe^LyeyXc@wi"|YW(*咶ہ~њ~(Y@ĕ-KjP>OP4uPi$]ZRu<&u65v4>!5ҬahWl{ ̏ n`ܤTփ@͈ڭzZСBmRaß %nEu.UNڍa`& N# eR}MЉ62VD%Y ,VèrrzH[email protected];o:H0$ $1!HCBĂ/hfȚfȥ3U\w+m ϡȱ 4"Tji@8o-ksq 36&bLъ\+Z u rPnF1qf[wTPU"4Z!J.&U~IIbJc ִ3ccˬT20HT|Y:c>7 fWHVÉWhtVADfO0*Pſtf6w1cĕ_!pA.IȓŐQ!4r2 UkP jWoVT|y%dw d g"r+^:M,x$U*G*9U9aːsN5AH$,|w#1ȗ@(KOgGHJSwgZu9:2L2pd aP`P-QBԆw:L)[email protected]sO TnE7x RY`2ԙo(+j`Iȗ;,&nT"fIBdb ٣XІдt08KEtKHH\R򎖝'(ϑ&dj bYVPŁ)!Q̖#+e7, Z( 1!d&drPȖ,`ҕVZӀA=Es Q(ֲS# $:FD9g ! ʴZoXG+)hV" s2bdctنLYf+ŒDle I!J$G2t(Wtad|5#JmE5 zNJO#sɅ+rX2) v[uA[ TpG1xkjꇏv^#ZzJ:oo*Opx8>+(؍nukq:*5_FMIOAS8ƨ<Qڹ?{l6[email protected]UG_o׷[ *5T]st4 G=!SBkMitnkjkqq5iA =!MqK>ꇏN㭆:jPA:-Ѿgl][V5߈놸 p5k[ f Flv//BjT8=Zl5Sɹ{'w@v n\< ׈X7T;:~::[6vtE<:)(5֏?s[ͨ_}Q=-ux۠?|;T|>wTst:>e{uC?V+9jm=3ׯ6ߏS˹ƒ׭}E1\<4!ӿ^Ne}{<<5SA4FmZ>V][i'z Ǡ㪝ϡ5ۅGo߫zzkk鏳TluP}~~ɲ뎸p5>m;} Qs(ޚR 5>ߠo*6:j}~x)\5k}l=/<^~O[yu:5kruUZ*{ 05CӏDPU \0;vWЩ>oT5ׯmTuɲ[ muׯT; oR4٪z m)^)JK=ʤPV]nNzo<Pz>O~|ïW:zW?)e{}E,nwǦ㶶mH{y} ?çxT]4$ϠPx6x۷~'y-|oQEXxz:ff>qxz`'scHMj/_vqB#og\uyp&YN#U~âkj=qyT8<ҁTUr/w`j~g7[2\;P~^ >ozA#og'{bI;Ϩhr1S6Hꮺ MX1F,Cy␱SQ++^sbM"xLܚX<֭HQ;`eI+6Ggn$Zuk]/"F|+3 ړM+٨qp/vFf߽u$Nu7(7jݦ;'RȁWNHhP,G*[email protected] T5.,,a %\4eDfQAPH5e`Z5`f5ܐj~*X99:KgJYBXѪv5a6LpY5*m嚁BN8prr1Xrt}.Z*A=ǕwU%ANPmxS6L\QꊥZmؒ%#bFljRfʪڔ N_V h61cJ6 n)&8ќDF֕j"-J k:L^m޾}w2lܕHCMJ8ԘJ-8$`Mkw`2̭k]ƵZ)ϙCbJQhGFLӐ؆8$рj\xfP̞!A GhE2kZ]F$%m&7TSQM>^A*A(v*I(NnWRl'` {k_*3kiem;)5ʚi(, GhX7G=$OK$hwtz0lgf9V5x]PD1ʷEhqG/&IeU!ob5!n5@y2$ZTx'7 Pp+^hk)B<@TDŽ}JT0E~4X- Gy):8}gZ*w >l>G1x{ƨMGa#y#ٯXE5e>_"i'G!Sw~z#{1viwq ,ɑ'd "\ܡ(E85Һ>2fISf5 Ѐv`cĨ$9qd.8S(

^T{{}*q[email protected]׎5?UO[3)=}_W QY>c{#ȁ̆?VΪXXUԣnn&wQC=3([X joP8VK 8[email protected]ݏGY*:>hm]}T }{Wj??9V#ov^+R5ƣOO{ Iف m)逕xz臜|w]<[email protected](5\j)`v&4,4`Hƞ(mrbu>1cRƁ$7)>O'yr󡙌jEKOP /e%\xB,JYQE$$"b&[gI  b)PAVUtX-I[ +m㵴Բ&XBrTC*@Imus|qs QPm7-k^-19uIFxM1,S+d Q.1d A#BUҀj&K 0i.L|C paP5q96lQ:셨 ۰4#LjːkD`wUVҠ3̠&TԠRZu7SYDH%vEndž&ȲGB[#IX5 A]gd3|eYo5UzƼU TE&½2UWr8kQ㱘L`jz5y**(*.Ş8T4PMoFZ]i-Ă5̚ќ"TBZ^[b:'֓葩kӹI>Ewyկ[߼̆Txn~;WG0?щ$xY},}E9z%jC۸ƥl<8 3$ UƂ)ddfPVēUS[1q@սkN†JvuN.ʮXڧPAj)jaI<uőhm %̕!ſ ް[email protected] ==嘓Y- GuqP A44DsGO6vnk٨3&Ԍ1MlM$Ȇ9Nc+VVr u.<-yNXQێf$$X=(UՀ M8j8eJ1*MVhGu5bH5 Jװ>.Ie^Pq(6YPRTMEI,ibK5e.@v :=J*0 q9B>])Urj$pc0mx&%XBHj;SX^([email protected]b-Tֵk$ ^PQsHhEkqPwun q)Z|X .a2OwVI>d[*2/m,\ qvרdyBG"H3-v`wԍ dw벴$\P;ksg5XA$PxX坕0r  (]ɠ;gQ;J*+`.M,={^I@k BBJԆb'R{4Amw?;~Uڿ߰yqSJh[email protected]nwV#C8'An;DWߢw::>s{=WhRMdwOBQπ+"(kFAk8T]ƣ`z6jfUTS&v4 3fUK-Ȇ&֮XZ 7b\̥OЀcFwZiS 0H[email protected]#Pz=krĎ`SZKeWAYQgʛzU%CPMMS˗!.YDajZ MC(X+$$A̼ *\ @bcpvx 5*49&`n]eH4"|Z_1w'^_ ӸN~38½(17eiZ,nil|gkc%iwƬZa5s[U[XKVơH&塦S,RǑ_P!E> u]>8sG(n* ҚB32,L/V Ӹ*؂A .kOU~M8o*RCrP3,Ă)ZPk.cIP]A -5S4$[email protected] T&jG9061xupFhbҽ8\xK,JČHīBÈWؚ$ERCdƤ* \Җւi#(@$QS$@#ayL-,U-*R  * UA Ե6{ ޚ,$&Dt(E)BOʄsW=0@[ [mnx'&heh6*Es8V wbƢh /4FĢ1ĪlEZ3qiƒF&WVG musJ ~F- ofR#jhN31\U`]XA ıH KDQ!% - u6ЈrJ ʧIe~s5 ӹr8yjRꝪ)5O8>:^7USnUZZp߉b~I;N߯'맳Uv=b=[17ߟVެ?82* XIXww:?vb'o臝q 踭 :;+VLh$ȬleT +hPrA5&tLdoVE?DP iSusbBX*ƴlՈ d\~I-/7$ndI @e{m7)2 {tÑ 9]T4땉 y09m'{XX|;@Gej$h@IUP>,2/i^m"RTm$h9AkQnmqm1bjkNʌJoGGvjnWT+m}H&ey/ޤ2Ƌ<||PU 3#j >ZjXp11PѸdG+= >>.<\{ oEԟ)_O8}~{ 7!G8P}dFK;$U0Ը$$͓w$%ZJ8o/'sMOrD^SrMI:Vk\i-BVP_Cm,@ 1;k4Ҙ,F3 XnILYR#,HjRvQ]fd8n&-71mX3hU1vj2pH r.Pa21c l(oV%Kl lR\;#҂qMv=? +YT0Ga:<r#*)Amʦ@ PNʱQl3sCľ͘&c*F#YRR+䪫T4݉c&RB14R"pb1X8i1tSp,Vk~>JR:5XߴQzk]ts/J{s (Pm*ke]&/ T(P'LxnnC}\6$})3 0ďWKj8 v7'}ӹI>)*rgh\p8z-}? jdF;G=~9[Qc;Gxt3>;?~1>l_O@NwE=}oaC =)tJd]NMjne c:N3PLB0"d[ 7Rt,r)  \< =VJ;* ʀ+yQ%t!9Zr]"Њ Ը _'EzطmA4:wLrPԊvPPA<0YP 0[QPncqP͈3>#$L/ 7@*hVT8ʏ+;2FTT ,[#\0U[w;(nȥgYZ zG)&.Z"إ$xv ki]*|Z|;Rzl^h&wZy i& T)ODU߹{ZSqL.HJҶiZVh}1(Gq[email protected];W]:U/ n3WS~u2DeP%L,xw/R*"gs vVzWPb\ҁKE,֤ X19r*QůjT;/uoO'r{[oO3 Ql{Շiц7h>jo_4qUF@YAVCwz4YImQo{{V5~̬b, BCō[email protected]E#@)i޻b˂Gڅ եAPH"TqBdC[+—V_"(qQ $:>,il5naP7p!W +M4QUbŮR<(AGe+Q\lhA2Fk 19KP\TV؆;%&ɆpNhƄC*ETҕ:1 ńl9U6 rLȱ{Z#($oJjø&DT4kf$O UhcbYM q;:XnAU!;)":_Vpmnk,J`A޵zMdy7#|JV `$ 5 p'IˎAL'ʐ6cpC.D3rȘ T!SØ*Hη3+fus8_z6T]7:6 *АjGᮧdeZox5eC` .}4G3v1U*0$ծ٨jjH5QclQcKD #+!kmϰԖ'W -!48л<}KNA˔V?{?. c<{9 Nm*{WbNެ?=צnuPhuIT7z߸#P}މ/aU4Z 奤PNi5uV,wq !)J֮T]uoZR? %DH.@RI<Cגeu$+jMim*n, Y"+yB)Vܝˀ"X( VRW׬x J+z(VSi6f%9h*W`wACcH*3{ƔqJ};ASuY mail protected])f$e`u Z0YVfCByU-]$ @-⑙EḘF0{[ը uuPnE( @yP$7|:",H P77 Sq<ȨX } P>".ز6V`m mSJ٬YGIm1Y׍q#P+V$ׁ<7PR8xxE,T%w!Rt| P(qێ9e2+} R` cJ(Fiyo[YYM6 23-GhGn[E,4ֶױ5I5oVU-fHĄF UuĭBD4,2/B:VjF=|EvGLP67XQX5!J [ցFצm#G*hqs@K ej0``wh)yVDU5ܫw7j)C|2F¨2\wj9=%GYfҵ]9 !+Q%BP 2cP $FA^?IB.4dھ]=0nSА7SђvzD=~?/-VV>k+,I>Xf~׸}lmo_TmN=tVCD.ҕo;qF?PplX7cru=q@N|oxB-+oSۇNdE ĩ(trHG7$>I*qCv*JRjx\ʌ?"Ypܤ+lhHN$ζ$f%ڋ@0-A[email protected]Q̒cOW,[email protected]inDb_n%7a\FDx#J I P 8Lr+}NiXF#+|55 lT )Dzkbș(+^pj٬EȆLY!ƶej7UF%a,b A+h-Fj chL/ Dy#W5R$>Qxa". QIێ90r*RHܬj4 #Lı5$I=qKKv?p?_G8WAX8z8sJWrOϦ^laL +Ğ7:Β\`*)d"Dbn;榱`l|fgkf_aFRK>:21I!37/;$miZbAbd=Bb 4Q&.Kr Fh%diMH[email protected] A᪵w+ۯrR'rVfOMvI& 5R:.&FeGԑ$6>" 6#]f|x?auĢ߆ځ'l$|W,CLSck,`H )۲_ U# ( XV+6f7cǩ#yr H']BicF{ľ AD2K"=>|Bp^Q uyl*IP]aF\f9pqqeܤ!o&7 Mbq&s+2s0].5$'7ecU+3]FȽmv ״{;>AIiݫAK7aб|w ٦cğ=ّaF,0@4nM `? C029 7a_fч_q| Eb5~WEXn=_͕@+F86pk? StG=l8@y( Wj\I ,jr &QϪFQWDO ߢ;#D;{CQlcOyQ;h>l[email protected]ϠA-,$dyIr$tAY D3"*9wPȐ,o*Lh-聁lEB$<^ >{0?"ڣP)Ph5ק"˟!?NEH#6AZrKRqE7Tm޵5uE~uvR~aɀS TqJxkp+ųWoǿn?<=u(|U5v;mݷR{G}}~e|ʎ:IC\~G٪AFؽi[z |S}-x ϰn~x@CLT@` nm۶)dM ǒ,x靂'Y# 04>Ȓ:C0bpT Ez kC^J]B)i^qxÕ]V 0!G wԒlbJ\@4*x ҼhicHZE&vP +C\i"c:'Pq8A[-?džV[email protected]:%gDt`J8&` @RbĖږK1%_Vºčjǎ͌H 7ޠke SJ[email protected]MMÎLwd7 s`[email protected]rЊT t;M21!`Ve!fiѐ@SbkvV<*>$n"KnZ7Uڝ?9\ 1FnH5_ct"l<*TQ[T7ec#E Xh ¨]EX4 OpOTW\Y6ÜHgH䘑 4 l6$PNt܌l[PRM `Jc`iFl v\w&5DaB H$NԊA&i)HJHhcoTǛ(?2%5o}зƏ+AESAپv'6e&A]B8R$ּ5px֢<;hNBcnci9C6QE SUۮnL$YwTu.LJT֪7[email protected]sߨ9r@B- [C{iǷNƢP.Sw㨝2j UMv۞[>c[m.ԦRnDg̟ .įgm2 mSq- P FkVRMpm9"bjm {Evt&LmAbAQkSe H' 5[jomfdH:F5Z(|5&:s,2ՖŒ-ڗ m\: h8 VPSVdgM"T3 v % fԱH CQphwtʸ0S^5Phk͏+$)*G$:c:֍{\+EI5鄙iqp[Nߎt.T3QEM}80<m5'+>ej; Ƈs^Ӿ'U-uԶ],05 x#qlIV.CZzqsfbTSSN}K#ddmcq.5 C`-.h76:BhTHbqw33s 3 аss2Xn!] 9vYK,Ҵ»ҺHhEJj4,Q ]n&Vt&ǝx 鲗:a…õwH!Nڭl*{w 8f?hi>L$Cf}~6qQ<tpZvޅdX!)jl ޔ4R:B҅DrX#VP0`Av45ӳ4"x Ћ;Ң tbrÑ%F6PE[email protected]1fHo/Ui$PLBiJ :X64;ձ0xv,F b\R Fg` uLUE GV%JBEZks0"{Y溕 DJ7);h >R,@]e*D#*XuiM(FmިµݫhqJ. ey1j(Eue1DѳΎ4EֆO *J5Eu28 pYZEv,I$kQ^[8F/IBՅAـɟ6?rIecЃV.ֻG(2rHB%n-rҞx=$rb %(JEjL:%\tj >' E~ug.Bz4>$ f)Xbc M#?YX90?*nuh<45mOdK4_ ϊJP!+2͂u*cVoܴS<8n(u>nN0DgP+2׆ƇqPzDCg1Rq(;-!E?Qmα a:U0WD/AF8R#V7JR9@Z( U1 /5VZLJ)P8hswYcbEե6|tb T(w$'$ Ğd\ jH0k4eĊr :H[email protected]SEEWb$U1!G⎕W/}5)oSեp\Dw}ȊƵC]GYBx!C7:hdt3\8#kne~:lEܸr(>%ZW`NէY3|@PK!Hڇ =zB $cEu'sZkAS$ڀ޵A< =ZJUv EX- MZrЩZn[) JmG*i.ý@`l?"EQFii9]^,]"2ºyFba&n{)M.KK ([email protected]Sb #P[:Pơo[NԥI#}"MX7P;4@T6FX+TkjOaC;liSmkl#p„`T  rĪ+q.6V:FT" JZ=mk3BHV𽖆64'P\ikqz lH\LZ#Gi5+˳A; IɭЈ톸.(pVh7?qWRƗ|^4Z̥[email protected]`xVXԒ WƁ )h5 *cP'Je3<.$O\FPPP|!BE-"B5TE[ *PI1cC,*PXNts,#' CxqoZXeƬ-QQ"1Ïꮤ|y-fFC5Va(^0?Qkw7xj~ֻXWNaen/~0QGWJ)]U㎼8 fb~p\Ev׉˟V R*V-U*7?f7=J7x{5rѓo/6>S4}߰k)Z`?6H?`tZ`W̸SbհR%TϼCW1$][=O>UIժLcc~ԕ=c~AFxWh0ø6myp{yNoa覎9Qꬦ:E.njmé`DʨlxI prA )Pj cWgm& WmKJu ܑ0fn WdT'p߂G fr8APqq,L2c_+mv&R,feE˂VRHYO  I-Z '(ƙ.Eт@4jx}Cd'Q|\Bw6hiC<5 0pTF6 )uOd` ?I;6Avpy ooVw5H>SĖt"S~%|I;>ko{>]JxDÏ}|Qc7b}>yG`oa:|Æ#j4 ޅ(YT  J oQYWvb &\SJ*UIjoP0iZv=hXL)}I;A~5ƈn9⍋(هj8ӁkdƷE8>#^Q(nju>*A`VLyPE(jAW, ]J4;g>ӢjAQj@izEd]+7*7ٷתx{x )_gOD>~{蘜0}ߑo?cn@O<۸ NW#]gz?-JxGakb߽v>zGRDcqpz{\__xxZ<=.o_D=pOU}*u?pBw`I6q'z\E;^; u4Z`y.cl}~Pw}0 *iSu6xyc$H6b$7RX{&Ucp ~1;k1")6zI [RqǏc^m8E';&gdEbV *A:! cnӶL8DK20mRp>zVե(]cJׁ!sLVFUJy @zYbŅ[email protected]Io˚סt"PmZ[ciU6P?Twv/h*|ѵس{~G:*Œ<ՠdK_]D UOm2? T2zP~PѬMFOFHz{2 }_MDҭ5E:ތ݃m8kd>n) ky_[_`:j;wo>>hnUEԥi]]Nں,Y'UeP-Â)#ն PSzvjsL?pjcSMuH4+ ZãoPHm}v:b>TPG9rP4J?2Z: NA[email protected] ֌hiC[email protected]%Sq+ՋZ)`I,էy\y[yHY1. T6e`ɐB ƅWަ2^’,b6wr{B/AiwmOፈiR{j8n ?=~j'4=zkVe@Һ¾~c} Zx5oy:=nAZW(IoX?_{寍Ft?|{孧Sd+N5ZzMb}5kpNg[DiuQ_[>c{ЫqH8R3V+? *~B7R'0We~f;ʌ_A0x%א{i$= `` ^޴YP*2x!7/6Z.U $Y1߹_SCFj):||iQPx$AH#'.Xh#+؋vP 5 CIaKU|+ߍĻ lu: 02A⡉XPzZedUXWI=nlj6'c*P;܏Y-8ځɽ 6$<5cL$HPlVkA54LvY]قBj7k3*,7RwƎ֗Yu[omi\pP9`kqؐAc%  *#wwvYE8_ፏuV}~dd/ ^>xHQ}׉PQOL;>߫m^xq#.}mg"I^"(?MkJq_T.1 VȥE -~,K7 fS$Oj=Ί>d |2^in h`5s1O`׹\E{Z1oJ'hr-Ԟ#j~*zbZЍby "%,#@ qF`w!w]u̜PPߵPh]P#rT'*Dr@IFR%(h֚8f^çk\ڐM8q&\KbXf JP҄74C!2ax՘Uj8oZp"):@'7df%lff UUCZ] \ly"`R(Ym_aZ;5}%dv!"5?Oȅ[email protected]&2%dEmړۿ)RĤTmZSdcB>Ny>)\F_wv:cvR@tʟ[>Î>OkjHO?>y{O(#.W=Q}J?h%> BD]ibIf='UC%Q)jZ.ӶL9W%!F kܤTCY+4O%Y$ xm(ga L2(/om#42,ojSї# dUW_VX<ҴU,i@ lG2G' Jnƒ~ee)qbMMCx ǝ!ѡHLXJ[RMʹI)\+VS̑qRU;M&<_;?yDkч<Vw)+B{+S7X̫lƦ3iS ZPkFB0Gs[ڢ`XT7 "-Knx!gf$ q+UNkb:**;/׮19c\P9 M]I` WiK#Q H )@‚[email protected]VNZ4RBx UЀM׮"ec"Tsr)!`BC{k. u\vIqJ̪FB@4_ƣ.>LX̯RO4H6Eq^aؘ2^G]yBQpbIb`I K"YE^[email protected]Z6|./ʬ,"s .M &]g“bN+(HcVYbمAcǏ12YVYAf$suP29iknA] 4B jȁL(Pm4Y n3E#\G!Y1HV*ZCAMu(av.ޭjԢ/vx,;}zgc: !w>aFC' v`|hY~EXQi?Q~'}~q#Sͭ(a>›VaE$Ye߫T =g~ݾUؓ_{9 pogEQ柡H8p]žu|%O{?#j7GWҀ8_vϟU;)~Z%N Sw?٪$weVB}|}~xTwo?V-DpK0?gc'JiN >E\Q=~?">_6i*}uX.: m'o}*tQT蛁:?f7t aޞm;y׎Kr >MOo>pS{G=Z߇ɐ?+} vo <a UP~'>uT?F<%uEg۠T5;5d (~}enO%Wc{q㯀:[u7oq[HGOq&*_wZQ#yv4aB}ޘC/_i;xChU8AjT.ڣIi^&4'_m4!^uhR>x_W\@ExVьqڽ`ٯ[߯߯߭oyzu_c=iSOխxtһm_ÎrTX)7.M=cPz ԿshLB}wEXPGt~~'>`2z}ߞZoPqN׶bշ-x/~Uf''>4io.x:`Ҁ>~.B]IEϗ(=*-Hn!(w?׫޿$ R}y.F-޿u'x{GroT<Ǽq;qXZpx$? ^ޞZGa}Zm_KO_o}Zx/:XkEϏ۪>Zy>'M?;ޭUw{}ߠ5ƽsoGy>cR|;W[3jp{e~Qox~d!~aFk{";G?`~/s}CX2wvaT"ATnt~?YmN~f2+_n(ISշQ{B?cĝ704=vZi-?Z}>5O`߰h;@*uYX pGS|,4IRA%O ~]_{G_:=ym)j>o@n{o5VS]]W/vLO_9ۿoo_:DP'y?cR|qhr{cO5{rZ+?Y_fR~CLzX\7vZ !U=BD5Ǩ2wL) :G\YuW׾fC{N6Z P?߷ƞžF쀪*^2Nv~ap<?=@*\TygB}~x;pH==Aίno_quOqGP괪 #=Fkqo*,-TtU'^ @}@u{H(_;jh?ƟvӅiEXV3~#נA꾑Wgoa 3Zݧ?AHO=^Y~ vI>rRfn${{Ovw]Ͽf og$|ib}dx~?ah<##\}](?wP׉{HNR?:kh>}uC!ow sROy7}*EP@T<[I(N~᾿hUwh5>jH*~/?ݥ+šX}LJg ppI܃[email protected]d?>]ѿUx{5{g;j% @mmꝺ3O^~r(W[)^k'!W^''_;$A"x۠A5ίh_⓸pg>2s?^}5S~zF')^k'^׊B~Z ORxP+nWVCwh2<{qԔ =~A%4=׷>`}1?A<=^߭O>EP߷Ao : p{>E +Zݧ?=ZiP)j=fοP'\(mq>We4 | ϯצcĚ 7S\MSvXDMҵ`![}}io>Ӱx[;^z-=?5݃CE|HkT6y'_?P>ӢI"6n;567qϯߪ2zΫJ; 15ȥT߷W){y>x+]x_IJCNv+AGUS|N:EQiPjA΢"iWo}ty› {)J7!h;țQ;?4Z7ǻM)a?{/~?|g?/?~xUaTd3,h 4Spqf>r=tC,ʸ]cS2qsDGG_ɀ&Euٍ8QU:1~a T H>( e1D>@}<1  WnXd=鏧?ۧWx{G}!_.?`?#//"?/nORq>QlTI5 uEY"\Y8U((;6}d6zt}“$lAJв^Iɦe>ϒH*T^!`9 ״m:FVF/,,2}D7/UaduNfȡX"^4b_7{/g/oWY˧ Up̪9#^O_wv{DG{? G=} ?W2u ky顸V%kLX',lɈ"V*s*FA7|G]IEU{*iv0RKBjߨ 8*0O*SHŒ]DG 7 dVDXC/ڙ-ө!/WrpԈzYF>&~{3`@QՊ~!wU8$ݺE2{Bpvi a}5YƟd\(bJqrx/,[email protected]{@'~G~oH__Cڽv"}!_;=ts ~@??~| G}OFz 3(A$ a̘]) <а^[~7,8(SMCf FP:9g/&^8L3*ڮ;'p f+|bV߾*ԪS(f~hpTS{GqQxq_d9ES/bb3Q;uGGP2߶DNr}ZwH[email protected];FQx ?wí*L?77qd%O EԔ?C# CuDUWw"ڽv"~]ޑ#'gwOߏFIJ]'BUL"TnwCS!{ [: >Ȣ!d7V0-#,w\8e)P맾ƜK8 >$>k >2jt0v1ꯂ P }sJ¯#u'A=QݢtTꪟ<*YNA1 "}$!WR,P"Y{tCKi7Iw1ım3.KggόAraPH)l IT T w2pzD??}!~]$CO>ڽv"_Gz9bH^?WwHg ljk%7dݦc80um<+J::DemWWj<Id[@#^]=z3B S:ĦxD*>&gn ejE;6S)>n=j:nqMv:+rA"(9 c"|.q}ٓ4Tr6l"YuTHs>)k8eNesO)_Ő=%9A!!~],?/Ww`}"v"hzC=އ?؟?g~|?HtXǵ]l#0)#pIWXT=^xo[DM(CvggrJ RjfMRѲ`[email protected]>q=Gȼ 7{{$9 b39L%9QS1Q =G0 NJE7 oydYOt8^bYCJb(LSJbz0!M/xCyhM"8ziP<3%uS ۀŔ =[email protected]աNez>Hޑ_]?G`}ޞ?} =?h?g?h~o+,UOIkai gF u*/SfIJXAY7rUtLbCǩ"b(=!/?싦re@:+b*b7PM;D"M%Чh"| *{bk,}yZ<1TS*f1$]3Ox__fOc4n/YD/A\*(BzFi$ĔdK2y,&?Q?ELsy?`!~M{~[email protected]ϭ'~l֊!9ώe6+2˵DkJ&a b7|oX3sް`%l}[VD1Rs5Mmd;U\!R2=y%5|]!2H,SQ2ђ{")K qv_,ZjmM*gn"SJXǕ'Ϗ0 ]&Nƶdݎ]$ ]=rn$\&E[2UU./!py(¾jѢXkkI;S4ʑ >CS4\GNU s9 5G 2 6vtʪ&T|]XܙڰηI H)Әܴh15j|XՊh L\"JU6TU,-jd]eiBFZ99r'_[email protected]kK&0?ȼ 7{ޑ#{|M:*& #qn0wvYY{]CwY`9u4pA"&Y1CP޽'NjEBW?m9pre5>S3 AwJ%Uj]{v7}QB>$y̰$񛺂?$/˿䏧O'?ɮDd[C4LfmG^sg J\iv&ff^9KgK9q=8tfê!'wrJ&i]9UEZYl(O5EB=T>:8!U3;SMox_HM+ fƒ)S v|j ~ M٢p(F ^=L8{R{tc\m\QQf0ײw?e2*HԷXXTCċutINS"i4~\V`2vB5[email protected]neͅNy R-:>*CRer 6{ `L9Ar&ն r/?#{Km9δų헄\f%dE 2mA;(~0춋Œ驗{M+cfc%,N)dUI!)*`2w#wme0%*]eo6q@GadˬrpnK(69R'XGq^bBXͷX5bk#<VU ;j;w\L@thռ| {Hr[;iD;m;δ2K" 9OƗχ5[䴿 o)ˬb8^!|63YDa2jzB%^1FJ8|NpgI&gZHԿհ;Jɑ[email protected]Zl{/BYXf"71=̳`T 1Zյ?Ue:J3r 8ƣ箷d;WwI0cm̝iB8fF#GK*7EL=Y:tW쐍jEo;`! yz~Kry76IIv P> aMA Wy)R7%9տ.C#џ5p.l51!cQBkap,$ wMN6ڨyt\G%]Vov<DY:ݏo^[3ҕ{2/MN[ :h\a".#!Mr)gZǃܾVj>g=Ɍ6a4/օ56:]_ld&K481G2jkh0;iᲕ(|cØOS.rB{7۶ DDH2+]5̝JFw;?KXko&磩{jVzX۩F5"#D97jFg+-m͒zk k[{drx-yƴ"s*|Ox﹥cG'_%q*$igT.ܡ*/ضdVrN*%հ5lgv)M5FA4k& (o"Y5>L)y_d\52a'a*IsMjV*MǓ_V^&Dۙmֻr>C;AX`xe✭KS9(P b[%vSW#Wr1Ȫ4buS^# EKl5q-<ͼTzo]].U2to sGQ<WcvbR7D,~н:)E"鮢"F24/d) rDTg E> "cDDo?D>Pw P1= Rw>GGm*1)NEfg}"=?hz׿OwvyP^O#DQMEYBI* i@C@DG&UQuEY*69:՞(ߠ8jV)!EtP{=4֍ˮlQ{Ma~/2c- ^{nĢ Ή*QrV[:- :˗ͥ["j6Vo^:&Fv6ş6r喱Xce%- Gm_+7_vZ*)X L:.NJ{CanMb3 QS k6i|5$%[email protected]ٸ]U;L# +R:mxMX8 +0y۳H[kȋ|S4|庈GH7xTlCvYj{o{ 1R}=öEPUTTs@G,k_v馱;~W5Vk?BJ9gY4z_#(gLwG_1l闋zjLЭeFPiD44OD/ryiě[-N %]צX*dDAL6g)&bAI@Z׽3) 3R?,߃gL9ɿ|tl[H$PʮOm4J.ӌN" U\ Ék|TU"X7d uȊœW* tfRNd%Z4f}y 5tH/FNMX-N+'O2$&/3c'P?0#B=:4pĹƺ/RQ݋i:J7XS!QͧNMw'^TI@8wHoOQ{;|FБ̿Z`l)ʀޘ~`L?hGHړhjXS۫sc׌<)K=[0Q2M0v' (C|c]JqiM!V.8zQ8ol#y ,7{ O(쨫>U`V%7J,6ZY 6M6\k'튷jUcھ.1n97"9'Tw ڱ=%+~P.BM 9[ 6 ^",k+Ćyc={ܔJM=t-Ch44DуrAd Bذ|R`W=v!浛7.1x4d쐗Vr8"[email protected]sG0uL;g8Hq-R ]}⚼wi93(Ţ@Qd'U9͆ N丽[email protected]]%PcG3(UI/gR IUT!v}Ǿ8_j #w3t6ȖFҿYr)^M̓gKM1I )D)uYë7,#.wY-; a<ІCւnvKG>&fɕ$YEmƨf}J@޻RLMDC f3jFO"E27hD9Kzsf*+Ie\|3{ $sɆM*#qE/ǦˠvA8A%؟8ض 1֮)zbՊ)W z zoNBy!fcs ՗nTG%[email protected]/ת}\eps8&T2߯<&vεU^]d9ʴun,ӜoST⟥72:k"|9բ,B>E)w=uN|# -:'1s>F7s^['Yqfhհ_9TbwO)&Uw#G.QC, U.t߉2wwf6J;^-]Uǝ*f=]|UnGrp+O;5NI:BmK ]aZA;h 9G&/v 7*N jui(:b8di$ty}vG$,%vr ;CFB"GFh_ _-* B|C EуXY'IYˤ!1Pd7֯/ P|ʐ-'N$d_\0PO=T 2:{^D<=JfƳ1ACF;] D[V<̝mƌj?3ImK*{|?0ȳu)w.Ӹ:%yEҊGZ"2[~RNMqm5)922] 6KޣW+>!ü[3U}PkY̰/A^18#Ut/>P4K: edQrµP6{;043W.PpșV*q*d1?Ynq UMvb,Fx7S3J90u!U(vڋbt% ɪܐZ:6[email protected]V8Y.˼%~T~ h"G!L :"]R]m9[%TH?p{yvH\Q: C$A-* YLͬ(@(,lN[Ӧv圽;JgzȬSKGMQv.c!oJpjpEUA0ޕCZ4S_qKY)|6͓YʫS)1PZiWb8 .b\G&(DZZiUJFXHG@Rkaԥ*Z)JQrJ1ûV9K9\xS38 DتOJURiHbx]40U*\w= h&C ck^[email protected]&|G0TT̴v)AZY?Q"±DGl V]g2lm³K&PNFIz1߹ F]~VgK@X`k%5ᤔc5T =EEyGW[email protected]Aǃg=Յ[\c0g /)d'9gM_%`hEuc bTp◩[email protected]J;fq=!_J!M-FO:It3%BVw(AXIŕ'+/ c=U9'޹ :T*Jh;U~ۣ-MT&Y3k`D&,QM($)n9E+c?8.-''QR~ki2mrB^]|HnL s ΧhƖm lf|3FjYQ(7I_7ƙLxfz0/>nM9-*yGhTEe'X8ѯV:w5^t~Bfۉ)5~mhG+i?8`8;*CuZƜVWJW5):^"#, cQTt(PL=P>x*K)lZ"yBk*Ic-]J\>[email protected]c%"|5U}UۭEVAU 7Okd|9Lv*0H#PYD_!Lb*."WHE4wQ͞·qn8g7(;P3D$ Q|'%n@-0 ҾU",ѵu?}VA3v]lAKG?Kio+y'_7cj 4)Zfn(6D'wcJ=YCGSWviGkxipi=J=!c\M"B(vgw 3􆚕C> PenV$5R'O"` slvj?ΞkdGk19_]L Ƀ *M!)0z-Wj}^Eu]cvWin H3XZV"qɻY;UR8}-J}˻K3KŤGDA-ic(\]K0MBn}Dd~ +:WTT(D;>@bB<7Fܨ 0CBR9Eu}b>lzJz;utnژ)n"D&! = -;Q/N)X-#HU]Ū$PJ`ۡ@~!7}20EX5h@Le;TH٢%CMJ$N,TS8 HȪj${QiZ0 &ؤb#$IɀX@;ԇA=bqt :C (*LQ+/Y:jQAЮQ!식'(,n[ R=p6~Q,_0 LbPz|ș97`;<uqߤ=#Hzr|nS^7|EŒixi+j\#fXUt*x L 3q#M.qN`c[%7Z-d9A]{fv-vIIs$Ug-\1 5sCpT"YmtkRn5{}lh׊$سO7,U}[.+;?&-TVujFRe "LYpF_#o" ntgv$*av!*ΊWgrtrG4y$Y`ƣx ]StÙId:7 蕪ö1^+!=f`ioiRw .P:lx$Nr|[email protected]HSF)^Gݡ&"^ɛ̕߄ynݲ58𼆉֍|Ug9ZǗyo-Lرm([J+"Ĺ?ʥm؎nyo$osqEVk߻)hNN6& AD.h,W7%VlԐ̜p3w,;v\8xwM x~LWNN|IrhmnN[email protected]T&њƶ#+&UZNKVDZxbD`UwÅ˼+wK>Ȥ4E![kPb%GÙn17VMKd~GGDhzUuX?| i^ 3_lԉc 1˔ zi]9>{`X7jl 󣇙ok̯oY枩mfI([bl o>W>]x%j*SPt;rh 㻍Jt9f ӠY lM,u6T|dERbu8LC] WriM,Ӻ]M&h d{cȶT+EA Y' )#!lK b^ FmUpk[email protected]uk,[o<ޕڱq%OEoVZycќzbO>5K\cmKt3N3]h9R^j8[&$\@ >3ZK3)M tˌ}h$ XD#bplUYE8+}yg| ~H55ɟŨQԣ-9صe )Nx*djZMp)FƤXYK4$DzMWAiuD?[>Rf –K*>9*W,0zAϺϣ s} R4cM ",\M?)͸+&vg&P,Ǒ\Zt<#KJ Eq$y|jqUݰ{麤\k`ec̈ Kl`x_ڗE9C4G/#e<<|\<3U`;]Lon>,jVVgo,V:{_ŭٳɽ&f*UT1r!܋`W3<^>3:\VrjɵjOe9Fi I ZA>Efo3"\JoV|@MOY6I[#e|gDzӮ$1t/u'\Q5L_XYwnYhLcDZ3Fڮ27nZC2|R%Ljy48SgQR]7'aǤ+lߣe5 řn渫`e`L {-ogĚy [\Jծo.a.e4zh($"[email protected]XIɾ~ʱ:WnT]Xw%xĎw2xo(th[email protected]FX&1)!6=^$:xOWqG;O1rGu.^0٢esˬ{Ģ{>߲u=Otn M47O5,\$p27C&\,$uiGD;j!J fX("k@@n6n{chԭ0ܒF·bInE){Tʓ(G<_ }ab2t譢0$b FB%C5Rn* .oG}Lqz"\G^+TjX)|g5bI~b 9dNi@ x`;MTJꛆR0%"E0 !?OE2D@tZ*D|+4 U#Y~TG Orv- [n}Qvb^"OӸzm{5b)X^=74(WY3_H7X,[email protected]n1%xEF f𹮅X .)-S9TLyI}Vcyѥ--Q;w/k/!% *dѫf g'vrxd9~N%,u^(G:җJݞbG/~}5\ЧY*vXnwq2y. ޠL휤g(,R0}V߬ZVԳWHYT MMIe^x(?tC:rfxGK{ӱPv4դJ~"QO隦˪Ä7Ku»I 龜sѹ[email protected]FRaۈh!L ;e927p=Wm*GU,б ڡS"f}G*0)6K2ݜh7=ב73{okdLdgS *L("er(cͫb)6"eI4ija6qz\Nx# \4׈`(Ħ@{mڜgWFe a,ie赡2JXuVaP}݄Yg}^YRMqB0}Wwj0yvtB/\fKK*I BSQBRalmiV,쒵i-鉴%Y(z H fTrdRPZɲqs[cbc]\ڍ(΢SI'RUT[ t)\뮨1V' 'ݺQZyMbuȬJj%ܢSI5 ǫ~oϾ 7hK(e/RgvXN) \3J~$cQ3=];FBb%@DE/{K:x>劾Q!UXcXt[Gdhݏ7(speo4 殺YXw`c&N;:MD8SƠ%s}VNJ]M| 9nGmv3VV#4HtM"YZa^.L91M3EUʪ9iy6 Vi%1_$Yڳ 6Cٳ1 z}h"%m̉5;;z^e"g D#Hdݰ9z0UVuzΦ3ʓBr ᯵tntA$A2Pu(F;:6;e wë[email protected]mw>u:>rnd0GP4-YfHsfvjESzUput?S5+&]pem'RXRp➲T7KlN5XƻxLFðLnt\M=ѫ+yΕRQ*CH quv|\J7IT,J~*ʁfݲBh.pԍ.rH8Up+Ikh1&"/h"M9Yhy5[JwjE3-x6ZmNZa']a&,= *gI.~Yx:ݮwpCMRrWVUF+֧q ̈́ 2\Ddw(5^^ ]4K3 .iEs"Go ڝsf\Q4z|fp[VYK@;ۈRp cvfu۠8YIf $#Q\}M`}p d ?U҄!˩ީ6<]Aolco!v0 ^%GKTxemAgp¯ 7?eP䄟.BU&܄ת*J$I Y5an 8j {Hu:&yQb MdolQS&nLG6A:wbK"3& ])Y0霦(06Ǧ_YYM4Uަ=dL!b0{R8&u[l^Jզ$sU \3*d'P)Tu2܁ɢHJQAXY0qT5hpa"_*+" FtE4 ;JP=!_'_7~|y dAF8PMz+r}}QG7G gmQ a"(_0t>@}G}9 wƘt;^M5]4^e*le* -f:N?p&'GL 7}Z(h6+"5WQD̘OjVDYcW`Ij9dII2nUG=K(FfbJ@DM׻xn)ȷdAa>"<{T@= B{>.8սstHDPCiUz?nΈVXLb\8`xbKDU GzD~~OG]7JCIɑb6g[$tv LO@:v&/x#s,>Q=y{YE'kzR6~dbASfVcSs|znqƍfv^Y!l`t0Ʈ\KEC QNJLmR9wATs|H¾\ :*E42t\5 C_1Ƌ5]ŗ/u2m/7%]TGzܳ};,6ɔkc=q5{|>sW괼"W*$پ=j-XS :!t*M,hj0-_-enn:aqT,0 Wщ2MckPK۞0hyd ܧkGElQ@9h[`k^?Dvkgh-/妲ԡӪL,L-j JrA]nEn8^rL}U FF\VA'T ;%Ѡ@AhѤq~B;68KH%.~3^8j4_#47Rp )gui=Ze9#m76qm6oS[4R+ %~SBZj"ϥDʕFT= ެYˊRef䖕B|iulw:rҞqR?H5Ug-9_3۵7¾AfZdKrkQt\ε2Z4s0vDcA?Ɨ\4)j[s<&_|Ư]>E(v,²D[email protected]7;73O✰ܙ^_s>AMD}'SHXbav1+·2%F1xgv'Wm&`$",\D\QBqԵ̷A*k/Î5xm2ʪѪո{ ~HX%o35d\)cuFṜ$ \P0%V $.yLkG~#hf 5#Gd(?%آӜUtWS21B4mUJAAEt9t喿N>OgӧSLF)9#$ŭᠽFj*1W?~y?0tmlՍ3#oT݆6?']ݚUD}Y%.Ek> R$=f|ɩfϫCU`E6¼roC[V=^u}?FfBiF;k{11EX0|' Dߺ"DDąkuHM:׸Mx@ %: u(w(?x}H?ɸ7;Ꜹ̤P:PπLvlTb0ƵObܨa(uEfPaAb!c0 LCD! S@{~H}=?Xitez4{B ΌD\Hɬ.\ (xn Z-LL)Cv i&2,HBD=S@=Cg?؟}#HzG?ވTڰ|cre* (d7%k%lO*TJ`ux=Hk8kXorX Okа&ɢe+nY$/gSVY6ZIzyHX,N~fbYQђMeM59 FeћFM1F#BHm~H1E,D# 94Q3Ս°95*ԨKds:nTJNhy۸M}%ٟ!t+C ݬEi(Lo, #oɓŗpJ\Vdom@#/`fd}m"7h\E+)gn LMmEs u܄^BJR5PȋT=v#0gm۴dzAj)G*n S4ǵ*[+Bکz4VZ} ,ACRp"St;ڥ1ȳ}PJk5,9*hfJ4:gP}HTWAUʣoN02Z ;u'3 mpzmw=YIXtx"Qo$ATN|ޖr|;k:Nkye1Wב-5{Bb*H$38M}cwWSP[X;3 qu^Q/.];?yF")ENٹ JSc당$.W* 8~vΚ#Z|Ćoz۳htEwC4݃!Id<||bܨZ[v1ISStuXI7r Nq[(zk!jkQSk8"oC!`w buriW'Tќ~jz3I8與]2HIE?IXRٹ\:Tx*M1*Dޣx2;&-9luONZVYնx5]ԪSr:Q'DCYw.MNT*Ϸ&x:)Z6\'[&{]G9j,9o]?ʶpBq5+M<9xfq '\eOlҜ)hrbǪpJ ڢwtU2ee":eUqi^FrU7(;DFDH"axLR J?1w'|Tю[email protected]K,VHuo.H[email protected]uW*G2Cq܉ ׼ !. )A6I$Ѣ@F͓(wMCQ^D~el_@{?קd$,q蛡릡Dw!@{xDA܄LDXNRcJHṅSXs2pTY(70C"騙ʢj&a!9 C1CPʵLG7 (RydlNؑC8>@}=# vo=dj^8L+CۺyRB1zы>{/! ܻpn(n$A")Kؿm~oH~=dGA!G>;GR[_x%fi _"KUDpa3T''ͭG032 .-D'lVomLTٴCm!M״Qn3E-iyɪ`Tm$+Qb]NkFmٺ,-.cSY{haKq|0ӳ{=9qeYU#+%(Yc]&VgóIGf-W/wkc%,M\eg+^;Z>wS7pT)-fvUi.Vy,TSw'U4e(2X,܍ؤUWmt=:j7K:I]·|j4k U)rikQwAc.q'yÎ-3rwL_F}Wۗ6P''LY3IS$ҍefku=71Px_:iY{+^KDP˪񍞼5[email protected]*p[nA,7>fp"otZͿN'#5Iv#11 u2F%΁ /h*]pj\ꥉXW51)UCƜC>z }KSzn.uPy *@SlS@D(r*p&Vh3[Q˕L2^qK&#(e쪺}%'|rK7as :*倲qNB%ǎ9f\dxL73ϩp?FD1ze=*WgN(3W{kt}=WrCn*.{mY^q\fЙY;nGfuP={{)F3֫;IxV3H=G±L?۟k%N7Yʛy$K [,t(m:Kg^˹gwq3MMi~QipWN?B6Of"#"œ"'ľIaiNB͜PuSFӮ:sɽS*r 1 fd`a=km /cK Xku=2a=3%iƲv/|J»`W a+Yx:Wvih<}̭fgN;ewQJV:Sz$'$- < ힱrN/lU~IyN8#Q$+-A),.dv4ni (C->nw;-TڍVq>3*j.elp}6iU=zs#:n7BX#KhDhάCUُbЩHW"*4c[XUϿd%/I1=? fY{H 3S8W6JvhMGo ד6⥞)*]vW0%AqyP%mm1n9ql_8Yu&Ⱦ2%|ٳPgFq֭WlCi5%-Cs`R8*%n8^--0]K;gr/B6i<9񪅙ꛛ-]Vj$^D:UCoz \(LSYªP1Z]kN70QRqkHn8ƿ2̹K*z}vlz :\WD޲zX'1/H>}kŞ]Q|z^զ5;O}R`r/_ ݰ} ?iaIkgz4 ֝tC)iUUM6hfpY9bUW?p N_U[7#Jm](j9IɉK5?(xocчHwphy*JFbF朁%2:h,e=sx<[Wh59!4rnr 6WJs E%F. L=)mS [z9k}QJ \@ٞ qlu]Ȯ9KQzH`b N x⌐ ujq:c3Rn }nX:0CȱM%2xU]d}.p:б1f0wr!?Jjm٩%dz8tdۂ^Q)D{G ?"uO4E)R[email protected]LEߪ+fA$ǧ옰nTK[email protected]}c~Mixu"5& CIJ~Gww`1DJb(LSz0t@CQ< mJc(tE4:H;GY0/)[ w!Lb*uCƃnR 9GUdwNk5ru*cz|C?bVG a")`!0v^Mjh3oO%0H>ȹb?G}NWn:WGySSD(C0uHJEŽ޻W]u:RDL! RR@DzflCr1CHvc,Qjlt:puνT,H\zMb&aƸ !ܳc&p G~?N効10,Q-U5d1Wi b̏Wɬf$Qqn`b.q)1Zd6yZ 9l9pˬ^8=#^'9%tjNUS=B3SgTRUVflvg].qFguߥFnUj =5K~k,fk[email protected]r&Aٶ'u|;6!h[a Ay7+- roir1O_}kn[W5 [email protected]%ZZM>LFW+r4b}fSH&b.MR1~?V4je~? z2@3n$TW @9ԟڰ8nc|iuU$gqr" 2?.O]9C2 L2⾙2nk.{z%F?5ε45nR%c[Qh!L3]cvCi;AI~Ad$e)IEĕʭe$YT"@)C7Zղ,YxKie&dH80Ex)T +cحܮ{lҭګ޳4\çTVy$n%to57.74{,Ӳ-"3ZuoC:Z/HKdlOxc (yeͭ,ؾl-vUKg3rW,(8̘ I>lU 2C11>3R癮}JVkԣ 4Ԫdc4/%%_A҆rDv*'ڱQ[K0:3 gaʣnv*`fąY9v',:I%q.W}`NtmJYG? UeEQ b"x"Drzq'Lk?&T&Ty㼝mr#MdTc iIŔ53t5w/DnnەZa5mjAfP{HM{GטаohRWTbU8M=՚8^yFe,UM ja!#&&8,+Jrǻ٫yQڽ6nWߴ7kOZZl#ƿA#nPPm-̹gW9X3ZW{vyƴ)+n{4P* B OqnUV첰;+-x\6Qҙ>ÔB9&>{u\5DDN[}.K*d3M 6w1j9dEG o^gEJ xM2 lJJ?]m1 NUEjNSD:kJ[ɝJvTוFMm1SVWk Xa,x\.rbJa6Kد6ZkLdv/7E;i\#KY\BR,$[&^E+GCw zvԢ*T5Qj)șf2U%;]_0.jJo#>Odrv蘵RpVu͎Z bZ5t/&00h:%/YTdƕ`4#XmmH-ԜcJ|yi;KU>+laí;%v{MICʽAbbZ1@bH8#W+N,QT?I vpkv;Ǽ\бvl߳Me$իTLlح fR1F6KKqO,r#gh.᭻ͫJHzTJ+Z Nnj$TvƒWICjx=ٸ-Мʩ|yB]kI%6p__8v;L]2+y~>Iאڡu1BH6sfStt 0ҭ=3I Y̴̯vɽK-ƿgZJt[email protected]Ft%^= YǶ`XI2HVJ15TLt6~>YW]q pHLP0#a<7IY(X7fMPH eCwa+t8O4,03iLe#piWY$d$2=1hDXO/=Gؓ-5'C&/mgjss5RזTGwOT7Y[ӯB)@o S`nP9=DUE1Q''Coj`IikBd($D{((t[email protected]=!Wr:8/5&dyܘи]"L[>o\i[X)QxbAڤݠnb>R,SL+Vˋk^OZLmƅEHU%˝CCdJ/e*=ۙ5k1$uv tk GZPѼR#u})Mq\rwV:٘G]2;/EڧYB DB{0,jADlLlŏq{`d.1tm.>٤y9 s" vfեRB]°9M8ӤLec3o6Sґ[mUvùSiA4]EzELu[U۵^G0W&oKi+jΨa8B 2>V9g"' m[>\^QI(Mjk_Gur|g y8z9AMݲeK-*cd]D#4گVCMSӆndܬǩܺD6J̌ԛt;J.b$5ʹs]c?ʲMkhrTRiO$H2hzqsQm^$Y^3v_7˨.EzC+C6yCkY6K3&tz>gn;ag"t:Xn2MwY>Mqټt]",m%Vf&܋FGw|vtVg]yS0DV]D[ ׸okg'첿8+>rҥcSk}TvT+kuL1s@xӌkN蜐hrvZE&yH)Ot;Y2xTM[DRXxEȆmF[i$ %>q;S7] EJ/㻗 %oqF8Yj˥$_eN+D={9vUʗk^KK~/$$>ѹf-J=IBjg ]a$Ȕzv/GEĈuEQN?S}ݥf\8{$utU\zP)JiM[email protected]JqGd@)GƾOY@[.!BM"NӑrT""%:`"[email protected]}!2鐎YDcW{$j'%(T/yNABԱ1N=`s +r _t?=D~nf[$m%u]p_&m5>?Q47zS:p:,a:qc wotd\*D!J̏6IE>Mt"n㘞kQncI{gV_0j%:'9s|F1LcGWOGH|b;M~i?oIOb!ײW~gA{[Ëqwȼ:K26n'Sq=GBx[-Fcl[yM7 *Ecj|mƍJ#MuۦW&5vE6+6.\aS vяuRV/lXdcxEml^C *LK$ o5g}WSMIUMf1&x9Caz9|[eWi!;^lHInw^l|=J#3KU, ~uӱ_,ͯijjĥ]屬$*i"*Dc'V%۸~طvbwеBǨ?Ŏ "^VV}MxI0htR LW՛mjջ[تn(#:N'6-=sJh"%}4yFȲBj9($( bVz/:?ӽr/w:݊ܮ AR^^6Lzř >q2S|cFxbJSbRA!+TYD<< ҥwER,&'TgfwIOA{&4w"kk??߅kO/xص[v T̋|%ǐhh'#ݡ1v )~9;x LIC-xag!ޯ?xz\=K~˓+<^\oxx;ho>agrh8ƥMo&<صyn?,_0xf4??\b=olw߻h/ W ? ~34G%f{7=O;<~?)Ny)i(~i5,"CLAKlss]8Cd^ɢ޶d܉U(t!}GO{'y= ke?:C Mfo9UA'# ݮ;Y8{a/}{2DU)ESĹv$U>14ֿ Zd0q:QDܷ|^ ?cg3o-^+*hϪu6R"AÇ+:knl;4˒)[email protected][vHrX m#rR6xQ<akfoP}b p>``%\TJ9 NwO" b۫4NluUZ*}4$7xx< J`0vI'Jg"1bPM{p#t?_z/+Vǀujԛ!Өx6KЄ[Y=loKn2g/yUEB)"Ma.(S eq*ld2o脾Q ((dAb5T:jp !>GNϜEw dR^uh~CO4z\7d3P Q'APQSv;T@Ӡb٢ɨhH*M%&( Ŋo- 9ΫnM0 Xmd;Dc \r, ],`5)ʧtiP&Hw;/ZJG'7OTI(ϢM<[{Dݳb^Ӕiwk%Xi.9WdcB'= htH9b;%Xp<+!MuRJiJUF70P;xɔ,b3*-e*% 8F;F_O.Ufu$~8lHkL$O*܀ !_k3ؖ~ԸF5;f;kvj6H4$4{tHny?cTkd^5<7{Γ7ǹD)Q6fyx&622pWDk(t]vN=rA#ړsW.{L5;0lNkKOD]($Mgk!YĚ͔@.NBǟz˹˔vT7qNC4^*ƴ8!ԭ-*nbl=ݨWZN#he+uduYnUoW=pOjW4vHSn"k\1lNxEf$%ek8-hjĿlnobf/慘ere/O/P?tl2#ZyB&. VDFl6^64^ˋawY.xs~Hu2ثս2m-&Z0LN ֓p}ξT#kqؾVf}9p6=6Ӎ+r)`#:ht\ +S1iJCqg?iڦŽbJ;,D]E煎R ՕXEA6\:͡NgԶ`Ct hdz0`B-SBY+Ά5iUeb܃[dĸ9cjsyfkFrL;lUu(T< l@lv^M%X5V1 n.j$,uɔЀc;%b#C"_ų XQt_FkS@j2*^h̢X% TX:DU.Rst\QudƧZ&fvYqPr/*h78xx(|#y/aqɻΑ-:Nc-#U`2Olu<8lsUˉ6Z6]?AC3M4|0:3Vjl},B!" 2kgbyVӏU(yKbW8-&DZ];@StG.3PSFΫ4˭ZثV]2hZk]YV 덡.,1#Qq[.q)W)܍kIZ5F}(*dƔ8鴑V/ HWc᰷jӥqO)8sE3zy*ęZlS9 *fґ1ϛlj _ bc><7:j%VSa-Qa5S[qclbJ:n%w9̷+`w:՗.RJѱd"ՠ7#?!F6+M=ڔJ38)^q(2[YW k&laX$ oC-Q %]^9o<͉ HEqVK}ݳ ~ewdzɘJ)x1#Pg1(5J=w fnadZ2*T'ye} *qׄNHnUU|SxG)YOVzӹ-Uvο5Znw`YG+̷y"L=_W27;v:ãH涌F UcfY$E0r-USKG [[m٬z8\>&Z">0L&CP2"n`y9udRV cgW)$$)%[-\ DV[%Թaqf/rߐ>Er ҷjZiA0|dݳ]_ qbS/պ}{ 2ʬ;Z6a#1w$ bwó~_1Ygb2;ݞ5_CDLs[Dsf,*&hOi(bxm'[uumR)S!$k;(7^;IP!+qmz%6ELj:ai+ln!f+lQ9kuFL jcMelY>cIk0qWt[cm9ͤLFH^GHE) $ݲ6|JQ79ue'U6`_9$2ݲ%Qe$2!DA ^aourPxIH>AG6IuR oS>s(eĂ=z7("~~ɵv6ht;BA)Rb%PTS /`ldx&w\og ]fA"8t_1r!a)r! b}rGO$Bru#E2U(B=(yKݏ*[)AD*ܠpM7ꓦʔ@Jr_S `};!!nSF.%1:fabGF"Yq(@Mӻrt~0۸i'66BZ+kbNDqpc_\M!x uLfiE U_B^NZD 'iD:)D(=?#:-5"PK{ C;ïP_l//`/Zڝ:N(^'Wѵz,f4ѕlrҶ g"ev]5#Q),c.'_bث,--#D[RIImzd&ٸ3t su[o%h5JHGBJEۮ;ε,xxFh1!,Y *Yw}&7͂ %HͫFFQr JD31l[6*MU'Vh<7ibjuC:Ӫ2Qot&Q%tjtILj!IJT~wY}>U(Ɲ+ EhR@6PI1{<֦{Wt'?[up4:t]3%P+jΑ6o"s K9ȞP@R JYZ"UܤcD%^->jQPb%i<9}|I9=#Vs ~ K/Q߆gk+:MJE61v|𜋏nI|Ndޝaj%?+bYVF=kgys̍( qj+!7k;T0v]_Q4r-OįI}174#:ȸ'9TH+r;V9(QݯS-i}+^!:Gi+ R-z0beAGH@ ng%)f]3$nj>ukk̿F2Ǡal+8EIA޲zVz]r]&JL!K\s{]vE,$ٌRKE(q_51LnӎƦy)Lո߰n~ Q+PV9a1{DAA)V5հ  m"[rM3nlnc;TLFR-=Ae& aóFKMsGlD⪔MܮxD8޻,y@={SMEr"W9ոqm${HT |ʢ1Ź>'<͌%%xYv8hI4d{l:⤉DNYbORJm&$c- ª | ?׵Zy_Jb׫Y*5_ٯSH[&5e}DұO= <IU>0u:՝[ 2VIΩ#GWn6k>\q<6.[\plaT̽yo^ii*Oj=vճȴT@9ʟRkZ4n|rŴ(>4OVFS'$QE+Pv9^5RGO\sǖjt)*Kx쐫8MLL| K֧C3^bsϖxrf g3I>4T&(d=iDJrtfٷx.WYH{|oGfyS;I5ub7+ms}; l-Vj4q&N ѕVVx2 &Eűt $U1PI>fn4[7*1?YU'=>cB2 [email protected]UVEkSWtDG6nG$wKi[qsU{3q/{KH'F93]ۦNl+u\|F ͓[ Cg \gWYH䶝^D1Q@nzuVĞ8.P.>EiNF2- i*4jeBHum`+չdMDh& r83[email protected]"3Pd:Ʉɚ W% x6{%KͶB$|nA\XZ[DlytH=@*uKD'(Q] U+Vo9zT qtԧ)LKgiHt\'T'A0&ssX%5_{#ji:[._Pt=Hflp aj)*~]APz"cxfqyS?9:Ц똠;Gi<4z*P)0DsXD Ty(~N"#쌔ㆵCƓٓ%ݧzdZDVNLz[email protected]}b\w;hHLa_AS6OpCW2d RHղ`F_ndQ7Ni<}uE ?VœNbXnc"bVIJH$eG"($7UDH&F"Chm>N(6u1d[d" *K~@G(hx[?OïNk ')CG"Q'}_ ~>ߣg y8 ͋im4yy9h<}>loai{aH:^M pLf/f])W@=ɗ쌤d +:#?.x@ݭ>%[email protected]Eb;O78r{؄KƵdyvw-io+!cimrlcY9* 2Qs{~Ԧs}85=7#Ƣ_UkWUz}|L7Y: /Bh/9)5-STsx.%+/9!gkWa'd5N8XlxMq|%Lbr;qiMc*ܧiCjG|ڥ@X(8p7RdX+gEe2c0s_Q3smٶf"3 ]vYW唪9!H䮉zfYunIH{k+mF5{FDmX%kF:lR ӃF)7S{JPAgqm_?]K:|b_UPraś\Wn6 >gja& u6gͭ6.a Mi >2Lp"&1DX-z{>ue{}NƻV~8BbyVFtWe+MZG {tGN9lo?Sd?-wgb/=k3!~_{]YL d[+#*X"ڝ/oj1l Z{+.Ղq.' oj0"37>լ teˮF22^7lvvaCkhYU: _8NӖΫ^R^/~SS]l^k*.٩B1˹S7=U Um3\vն?Jme]bh£{dx4)Jdr 5:ʔ-Gh);t$=p>Sjdn#=8zZ[email protected]1t{[,-s;U4%hm.+*YD? mJ:B-b4P\IU.ql_T\5FQnC*v^;C+Ѫ1וA E;g28hkMgXРaԨFV*6kL*񆌢5|{7Eu薼;#NJM!uvTvvXgi5r*e#RBdV}z+)_:=w/ %-)N-&0LrrêRyvGQ~ >Cq#')rsJj[cfTG00EkuiM0j6Goγnsִ]DIBYATU!1 >J_21l]w4!d]#wP;azK$pM !`mK`V~ X]eʖ{-/ %A&k0GX9*V:Jd㾹\_r\b+~ 2JPP#Sl#NP5钃)Y#+.ˌiT'`ʵ[!t7DJ\/HvcdryJ=HDzmHTL _~zxeku+QhoA^{z[$D^HB)@"BD)p,` +ة,-|hg*U'r)J#?qE bnnF%w'-eOO2%AרwYc4HQUT0*i@"#[RddpQ/[email protected]˓Wxtu\TJ,cqZD|5cO}ob>Ep{GNz,]1+lo{mBBr:tpXy}݃ABj,,dbDf{*װ7kV{Pנ!(nfS WQg k6p [7dnAhP?(/gqZqw(fݔ3ٙ!oQjB!%"!P(~p܋ȹa\FhQ"w8^!ꮓߑz:$<` D.Hx\A˅ %ŝ+>h&4&W7tC9X.37c~ IVlȰԍcq[k+#19'lf@WE $HЄH_n7nK/C>M;z[Gg™"&(k]5G7 $#!{Ԡt2/h}&cbq|c6Go8/սo$m~&)]Xh tgDj&lG EiZ#)[eajf&2pJ[ygֳjO,"VVHIEEr1OTr|gMx\(Zw$lsadj։cUR4Pܚ~RiKtFZW)7&s\w ]f& f!ٷYRQ 2N;<^ٴٸ9|>83V,fF9J )$^UiRFfH2{8gt'hU暿-H4{c*oVˆ@ɢu,IZzJ4|ѹ$+Jn+U9U+k@\FXLms2S9Sn]lekq"YU(Lu3Yi+L(3\܍ye\Ghq"o8N!ꦕۑ9$<dn7e$. …q3T+|de<,7UtJAṚǩWig4fxؙ6OSDdZo$ ̖vzflY)N񢄼r>69_ 14LbˬKʶP&mjYpEvյyGbȅ`岼Bi= 'jS#,R8? r"wݴ"5|zÅ3]e=Ba>jxKdZċ-&hꥨ5 L d24[$AC~RY'c"I)x$*zeɱQfg~J9% #ePM"(sX7쎲W9 .eV.3L%? GXoNp]ũB &s/x`N^6łl8_cB%zLL&*7PV,Vew=*51#MBhm^H/a.(fqE¹q1}ƫu&|+Ry'+>Y*x3(?.lBR5#>&p]ҙS]Q4q/dc_6?ܳ -ZmތxiUl^<> >h7vh71]*J lBBr_TJ1tU%job#%VA8'3%*1ݦǂ!ZCm[7{(\\$fwg'XzܓڌBj&%~bcLqClvGuxklr6Oĵ,CFDZ&ɹ$$NP }bcx$*lbtY2! =<]岆MB!"Sz"ج*#^X+ҫdB>I잵PSpfITxS@J! Q="Q=]r.Y C~^(IEY֦ LQ:JD!JrbmqW /gfrD ^a¦X f˺qܞVB;VhY-j:$e UPL!7Q0FnpVUj MJq=V"UD0>ͦyF=A7*DFw3C=}kRmUjr%1$`w<~4DPP1s c1DDDG?\t@[N._P:u^ҭz{4 KS >_DzlT=e#؉;ހ?og=Qr.JvUh/=#H}?h?'n'cʯԩjҸ2A .] WN2ObA8}G-¨vUVy.Ѽ-抰,L{õY"vTҪX/ct^FYq'RU0HW7{MlU~=n6LZM} ?t+1^Oٿ<=⅊fkwDZd=1kQy"ٚ~w uwV;_0,E>ouwa3:=J=ԙ>uj,i irQ PD|¤0ۮ-Vss%5eq! E:O"ۍ)Qv[':m(:##mwlVZ:֠kDD, qr,ViY- Mr/[[)c!,O[9:dHOæ2zEZ+\c^UHiǍu<$- bѨ|ˤRAbUW(`8t[!Q넚+5i=ωYBMɣ>4.uzfbJ`UauIVFR~RycQ$8hh$>k+ ԕ3G(mv0 +d%*(DJ`e~x:jWr cRacxEdRfQ !$7fr_*:,[R[qUjUWDT&B&n&dV6; C˱w+p@5zvfMv@?/o¶8tKi=:^ r$UN]'n*69ʱ @}BsWyA*fQQ$5>.a W"DJUR9NQ0vڌVY٫؇i?]Lcw-MdU!NCJrrIHJHQ䄔vkUTQU&0Gg3歞b|]?\4d~JWW~QvOBtQuSvn+M2DQPD5]BKam##2 ܴ+/@{""?8D{~JKLP2g)CD7kZdN`Tp#(;P(W#"/ Ȍx~a,WO'? } z}>qpSmprҍU5_-dѮ,LgDev0$$mBeegsTllrH>AeC9gr E fN$FA6\BTӦݯ{o1-L B+Icʮ4Y`taR`j>AՒ_v؍SL"$)gT˖97#8)xgz6{? -zַX,P9x6yYp=GST7siUکfT\S7D=y !"ܶv%XAꦧE6 j_rTkwojA{y܏ҟHEQU'Ev̾ҵ SiBj'A-5R=^O4,H3,Z4+/tCқ_ƴmoh{ACe*Xy}{zgO`i4Ufsa]'2je0?x4Ze< rħfDծ9Y{ZšU:Y9x)SvTf M% )?!43i0_!;RٳMyNS>[LEh(;Z>9S-HB|A{bh|X{s-diV1 Jm SZG7f{*CWtY?59Oi%A]mvei}F;su'#ZHK#*xdخfޗ8Gm虞QPU56.ۗidkMEVz*qAiL,K˜FC;zw_ڲM[*rkpufRqcVK&ݟGH8 Ȯ]qrz}{kYdz|KtYċkn5t+ޮNI/xrRCF~ʇ֘/]ObSyKkŢu}VsdJnMIќ+9CBIy9hxvM+*2oYcn|ЧuzXx׏DRKRϩ/X9g:nTl48W#VK, UeQ36~n: VӏmM'"r/E9~.]}䦪CϞT[MxXv=7g<7l=, ֨":çZauFM(@(0D}oH ).PEAt$e*nT"JOWb`zt zt!>ϓeoөy"|;w_g?/_5h]9Tn *sxHi1Y.JHr{?jzLE:bCxz,9+G5׮gkvս0#7VuZ$$(uW"]غ#BEӳ&ժPM"!8@[email protected]0=F%8F{]6X:a=Gߩ'oH>}#4HMTUPPH&Dذ Tár(i6WHww~ϻ#^3VvR4*T3u25Tz&b?XpRo8# 8xeC"/:a׺Zn̨cQ4ӷ_81Adz`8>u SW `e8 zQ5K)T,ʧAY#&c,q(!"w[email protected]F\9TEd}1|Vв( q噸CWjSX/R!_1X#!sÿӧvLz)5'%:w W)>@}= _'~_W|O?ESUݟآqv6H9jK3dU7ѵiein,JݜR.pY!=9Xmz pL_}a榵Hm.U"6hfNpdpQo*O@BYNQtH S`B_?gnS\XL>F{\2iW Λ4Oc8bE=!:-T~WVjoE9fjih{Vtaf]aT >=a,\Ta H}]NPQƬ_-Fl6QʲbNe( R~4RWu1?NbWkO"uj]?Pzt)Q3&r"S0r:xɩSE$硌N\E6Tvt^Z]ӧn7wQ?8zON<5]MGBhU:׃S?mת#ІB.=al &n@PK;ǡeWS#~|_@驊96E)og{^?P@}v"#D~ň(I]X5'D:aWu#w{@@~>? ~ϑׯnh9g)tnGS{o,J̽U `no3qR,",dK ;d%+zZ,ܤ;F YG=MB|;u+\eB:`+ 5iSvmhUP4;~L16!9s_ca,Ю^j|N$)-4ϛyb (7dvyfK>!/.:1\,̳IhVTIdxۮ5yʲ;LsLuBbWZږy3Ma`Il{A^V(zSH~!cbڢɊ.euJlnB"I>Yc@TPiĪ3Qymnn/c7W-^:g@&R&q - aq7J 4zx.2MQٮ9y J(RXA 2LTHs[np܃@u')NSsQfdQHH f2"A a Y>v"+lO(w}'6{;st '1ep={>bvlUR]Lt![,3 vF'_ݜpo,s 9{w>_?ƉtOHt2 {'@D^c&Wd)O>}WUM'(C&7sR6QAJVlIR>ji)X$I!;|0OX28x_|ئdw20q@/S^4ئ ed!{$Sm ]CN_G:fԦNC[k^1w){Fg)Ϻe^MAᧂI5J&*ۻٖ7䬪R5sZ8~MH]YR`U7FtTR9Ğ -/ݲLA)$ŅywW !W !&P@{N.xZ&CK׭Y-9]"Vl[email protected]IpJM6Rꀘ6=>/I:c+[l-Z+^uhq8ݬޝD) 5cX,.U7&F>%—pLF9h`\U%|'LMqճvw)(#[!ݽjQ"u,k_v;ZȄs UhGQΙ mj( uC=R5*ZLض2Dۙ!Đ-h5:^W5\|aSSܫr:>@OaH~.^uhz5!lX γu?M>lK$} vKiCmؓ< .1i$%v5͂`pl>,T;5p)-[$uT1HS;ZYz涋osByd}]xdD| !M2K\%X2Y JXcePJ*edxT{MUt+'GeV)9YqX[v׫-MX989奁+5)!pmVr {>M^V֐WX6E\ hk,q|pQECziy/ߗm\S}:3l8 _fZAK/E@1@G{FOS1>Cv:̣Yot1IU/9 ęA#usS7jٕL#UQg*UZ5fWkw5cߕ<*y%}^-VESe=bZ>Jolsm[yȼrO72eH9}:ŲXKd=^1I5Ye{5zfMۿx,9}6kJuԝ>5f=jF.HVOM ]i-8ɪ\mrp:t}f]+O.P2E~I"ڱ|NQ2KCӝY-GZ4y*sT.RqX `+5g2 ;%^dɟM%LO\+o3J{39T!/oLF*v&n;oyK%tDp-$@G ) )5zMF!H!oh)HL$]eE"$]{x:/@ OV rЊMkqt8L@+]~?؟?!J#;v8=#DŲZQ-Fy@Y*_ߴ>QؖKC2~b䊧`|K泘T3&dԬ23ed,Yf-rxC$gktH\V˯9Uq<,m,:\ E4z\|;fl'QEzV㓘hFO&'ëju'K^!Hg5N4T걓NVI}*́n!q=+7fd6Z65W.28SB.HjZp+FL2;Bp[%ĊRy}yE̸1rjȉ- PKPiv)Ux"#*#TAO"2"Rpo,Vp/5{NzӓZY\b, /lK,*$xrbI\؁Ю0/Y&ܜMEI#lO~蛷#gj]񅍋D6KFUa_ OtsTJ#Ӳ)Tt}~0rkPmnLkW<ڥfUqtֱsi`^%cF0nbh_NIҥLˤNĶ`PMs cXvojV,"IxK)oVLtxE$2$2ґo_r\9LZRqiM5kE_u:3k8$yܠB9VI5MrRSw9vإ6%e63'.7I2̾nKdhw ֤g b%1-I_VU YӝSd 88 ejx^ AOOuVaDrԟ* Wį8䳮E|&4JΞ 9#sk]AX2|zyd~+޸[email protected]z!Ox߉T]M۔ԝddQVjD&M]ctFoi%"GTPP!26l\]oy} ƭUNlj0I\?NG}*+ D =Bq?.}tŶ%JoC14ExkQ Islݰ+bEK7]|tgqU+FR2Wcn"*hIF_1.lSs`()r8#sVäż8߰%=8d4'#rTPMWDEy0Ųe<Ƴ o#/FCu1ə*-n!pNŔ^9Bu2rpC3N)I' Q{P%cծ'isC`ZHCƉ4/\;q#ᵢm3-n V1m  {RNY1T"_$8xŬ:O^\J: mu")A\CrO5 8moy5Tfo1E{5( 3<ۤ&F*A,TUkAV/lˮ䙩4FMj4(NAaU}MfFmVjp5 gOub44 5\6:;@{=|M?a=D=|Ul8PPS+*yF#@1xV*] ~8LL:d-r2]VMģ=M,JPm۱sSݩU$vw9ܒú~f{VMܴNO-vn0 ;SgF;Ƣ.e,cmPyΫg+תcJ~9O[dgUeSdY4 vB"%g&U4JžhiVWnejՊ)9'fP ȜI#Zf`hNn`^]kPRߙz% >Uk*ĥfX_5}(){r|s~St-GybM0:m/K)YHr|isAf 9i)#7}qqv|!ǢrҬ6FEy. 2^ps1,sd|g?^0.(mٚ%V 9~3Tt.NHnH*tT3 +u>O+]oG&p~D-I1q;\J2ߢy[[email protected]7uN#*Ha1KY.vZ>ۆY\ח_n3kUÙ H\nib1kL6ڥuN#TZ*~]+>Ě=gHH5!"Q]}&Ǎ5tG^5v[Fu%n GsCi\B:NB*`eg`ݱΏM 3*PUfBUe&NǺfS1m3T3QcWFs52Dxs|rl ”W|3l"k\3Ulw?$җ!ddHnT+#S*v>igzW]SsዩXHw&:]%)(`5M^LzqN65b$,b*F+.t[$ BJPaT#Tӻk*,6IONF!:!E3TE5xP:,(SdMӇz%+N\EL>±a#AftWn3$*a)U3!Pcڄ -aelS3ކэVzҀvN=DGw( PfKE747%pIܑG(4ǹ@2(uP:&1s9DDDDD{?gz^T"1v1D[email protected]CcD3g&ua$/g,^"vٮW((ɪ1QH-}ΩI_ !@ >?vY5,@G(a `2Ÿ9z/!GOgG?OzD>@@NsPY'IkE:NaՆF>,'ެtx0 1ߧSy#Դ Bl: X bi?eN~(:+E3kյ۶:֖QĹbkþ|{ިܫһUA3N|宗_iZ>JB?ʙOU[T-k e_,7j&蚅s(c9&pZ5YnQ ɎAZ.x *bٴiEB  WIYWlOe ٢Eb3rm-rLyTkK}w*Y YEg)e# SUnzU_nlueХbmՉhzzVxD Rhb c~U9TBn7&J\t’u;[N3vQW`s(cMSE̶96>Zkm2B4J= -.؉ yJ:2}Pvt [H[tۥg4[4Xƚz%+*, Q|fuIx̓R%3<BM:jSx]7dkDnٙ. "HzJPc3ޮxz27XJsOTcp^Q&r pP]7ͦ]kP2jw kiihWYݫ4%F*w 804 {j֠g?1sZL&&eX9&GgYTuJۛ"ͫi=0XHZV-"7lG#9ç{I޻`xO)]U9P͔Q9ۘSN c Rcjϩg+3=HVPF\5bi&fd,E/-uJjV]ԕ:—QN=)6ZȺpnQʭ6LB8.RUcLņ\SA #y`R/⚮?gtl@2dRKؔLAwwԥ -AED4iV+V5ۙ5>k}aދzu[l̮uh;5I%$ f`"kHS9 v척k;m5V+Ec'+3ёSu]Apt?f=KPu )AO*R OcVnxpy)[WӤOد&3:0Qu?/^萦hMHejJZc9$ 1dI8iۊljS˸^<7X*]$yyà[email protected]bBE276K&H)iwSP[email protected]=r dz(zuU)@'P8dT!M.~&gYHd]yf64pe a)K͘2$BBAʞDl[_H۷'=fP@1 +שPpYLPP2Zi' Xz_?WoiOJE{$55a'D=fg0L=z>MxB QKU} {‹ӏw=}L:BS)JP1=No*"^$ʅȪD!}#.?a=4lKVsOl'NemWn"8)U1Qu6YdșQ8 LݗKl6_9F೺.Iu=Ǖ\|:JF!rpv`S8oۈ<˲N[crG6Ъ"MU75Zaܴ+kIh J2d$YvTy;;M/Z>.rsAPg.h1:_Q<{(Ě"u]v]Aahq#ᙝPSBOpm4okg6BR*$-daY۵j+%A hhYUJĢ")Rg7=;z+P\ft{gL3K7GUI oQ961Rya5eQ/V=3n>JCg9]Cm4N F4]Sw^7<yI'wJw`گ9jwM}TXrwU@2֊̇;Vm]nlv716g.[\oeDI6FH""DۆUOa [s-xU}C<{oj7:N/JB2EM"3Aj.\l䦳/%rz_^LI(]NJFmҍIӵȝ{Atk^][]v0N%w%] QG6cnm]~/q13^SfpD&W~ŏIʲ֎Q^Ls?-vȟ0!nfҬ$c9WȰ(Ϋat >fsGs㽁ҜHΡƼE(#?(-@6Ol1TP D.8f x#-Q5 "j7Y)e(] ,ȬXdJC5]MOʨ0t'tBbv[ZohmSOQ#K,R±hK99"}¶ʅc:eET6ɜ=+j&ٲpPvʏwyA޶:T}N=H*ΕQI(!pҾ#|m Ÿ:O?V2h"D$&JϖТ)z+z^b:+E|#q'Tʲ)z%Qѭ:+'@hhYUKD$)VjxҸPϴ JKk#`z]^D'm+s'4[L. _mo&%2?r&f#*]5QڵVMQE&Ń:7_  Ƽs3 칾Yo9xfrJ{4rR¥NPl4ʔ50zqi aER l"ӠvwChnw^@ifFu^G<*q;L,b\JIv疨||>˫g5+2&ya>VǘZ勚c4#ue5HtH Α*eXs,fўq.B?䝯UTz9rԬvi79: ^I&$=)wrB)tmvf\NLFhmi$tRu bh%d''Y~.roԷĂmIlZʛ^ѡPgu2G:ifB s|^ q9DV⳸y}5~2֭[Ӫ}l(odWrY&AAY^96VǾvJQ$ylkrs𥞍H.X6!8Lj\Mӳq$&ldH㕜R }u>QҮIV)E[[]DPy0Ѫh̻!~\K?s4R٨~Mh}c򏩶e[U%?0f%nĹ+)6lWQȶgQ0˟9)x]`7l:*Um܋+)u&X]uj<+l'$]hʷ?{TWڎ~gz¸ZHMIї, 4Xq;Y"geOnC'"STv7N`"iĤ3"[{ƉՉ_oSMBGkV5&ZT׿~ZwD(eGl[ݫqIl̐f$-"Q/C9MC4W\&m*I mClELp'͚>op}nfJ{3DX>Q([TWf4׹hgV"T=3Y7kqBop#xǍct\i[e@mS>omom?wWvҗ!r0o&RvS7MGo2C2]-sLάvy'Xa*|7%UxtI]MǍj .r{NiTI'9hh%8R}3iE"> 9"!:aJ_7]Nb_5)m#IbnuIucVF葈׫k8Q~s[_!htfʜ?Y]{Yb qN=mWMcijǕtR.ACkwӦ#miZ-2_1ʸLb5(< Ymec5!-f$.ZH=gpZ*Mw~\!-\׵Ym" ;f*di,nnrcܒ_4%אg00,en gҋ:231!+b@"ެ4Јn<@ zswx_Θ9/A k` &>|G&L&EE!*XÛHb.D5%Vj=#cFN 1ur?P-LD㙝hKdq2Ub"D;3)̥3ʚ`BܙЙ9E+ġb3nd,.)j$e " oxݤg1/V2qMq/<%rBP*C|ݜGRDH HF;Lcߣx4P0Gۯ3cx?Tf:xL<:[email protected]6+ ` [email protected]@Y\ԉ|U8eNoYTs~=oO_G'z+Fki)g֪c!eYċn0u(!ɬ̚1 b{UOF#EQs`yfA=j!P9aYO۬U):P8.K3On B{g_[{ nm~x/Eަv51Ne.Z.jnTu +4U(&E4C|gHzsX-ӉVo#:r Kaqvetν+V-yj)Гu݇n"Vk}7bU1v=Ez _SDV(в3fRZ#DU =RʨHUȩ ӳ*=sQt4eU"u봜F±,6Y9SC>#"{OkNPEEWj44mBV:7"cm[email protected]Lš^YooKKC7mnЦn$sK [0jG\հUU%u[b[TJVVLa1[k+DŽsmxr`DR/jW5YtS:Z]Gݕxt=Y3mM *'T96E5e"~&-O,[U/{kSOу,stD o~0rf8GԮ7Yi 2Y*,Nǻe&Wng)h^K:ߩU%G©}SUIdt7S4'DT=C&dP3Pm9\f3$ay^.bsY5t'!["F"IEhuDlp7Cgvڼ"I/*%c %Jp0>ߥi$ hfOI>tyeqzn^%sEYla:N\cй55y31WhЌتGpT$(ItE\gG9[r;\i+t;GYfSOe2쒇Ra-D[,FE=c>PkPtJ#2+t-;bI{םE|dNtzVpNWtC{)6'/;={fFV;̭KEn""e*^hRzťXZ 5FLD{Gy> )boL-"Qr0ՂתO<2 r4~Ԋ$DhڻfsC83Ӭ|8W.fɘɒFi%IC(rk7(ԋM^pkƋhvE{$ Ҧ]0*'/Z=*WܕEVv/~9ZƇalQDwTN1v==E|2gTU谒 rm1!FfT][email protected]As*T ZV-__ߡ#i Xh4;mz7%؞0HZYCEuntgT NTqS XAiXMFSv"kAYD&TP^]nn=qyU>V!ɸUuХcJh ʎiZ)oXLm;l_ i}y$G[flsy'jFP79NhE:}]?W`j?4Ld}Xb߹yGo1Cs"+Raޥ)1N+w(] SD֘:]f@YHE#%4/->"12rFyZWXVz[wh7;hg(U9 rbxe9i+̢RoCȐC'95H wn-rʚlV(K}vŎ(5W2QGA9}"@]'Wױo8dtf{PVd/,ƽI8DlI-vM`,iRUY{:.,$S7K;΃G I{^Kiʫ<5mtA4u1uMbzhyas$fqy=#a9 3Ӏ4ڬr:K.,js_s=Ӆ1(ZK*&yAixv.4Lƅr0ZHj*RkZ[%2YH*|{k&LLR#Uax4LCo|.X\sc*QWZp" DhU|~2ư:{jGͫ[< *uQ~I}Ь *\adSұ93dz_6zG:k]*`l4tZ}JELhW٪S+jQ st$Q-ȓ &]C>L`/4c3_:NuVklB*gfMVŰVNs.{d\c"Z_wLBң:`V[6&Xb!&M+Zw@]XEyJ3%b^j2|fy^,kbHPL갖xʤ_1mwRwCevZ$MOs偭MmǹC ,$YWY%tuQHxotYp80 K]Rb)0 Bڧ:l{E[%{ݹ}^EVQй0GXUi*ze(?r$xU:5Ѝ.JVpK5O=LʀYsWn6L<JRvf&9۳L1J9%gO IѲrף? Ulҷ(nۧ>|ʡR)X-*'󌱬9^Ł3j6CcJ]T_yxt+ʁ4 殺YXw`c&N;ߵJͩg[(e6LǞ;. ( i#%΃V^8~>%?ts: X~pv,!S-9y40Jvz+iO`K_,j *[vރ̂P$7=2A؛]/)#]nPztJ)uӷU/X( zΌcӰT'OYcXl؆DmoHٙ>v"P;q8|^)Oٕr=:v)gTzT8\q;PW[email protected]ƂeE5$'$H {yNSPl)D9!E"D>n}G;R"(Ak<u)]W$1/(t =)l}"3ٳךf.)H)$$QDŽD鈔(g[/%e+#v%%%qd*el,RD+TbuCak0lN2k1ʔLG ~}"??OҬ`[email protected]|+C_Zd񋬶`#xb&a7?"?_OƱVQ6̙d_=FQ/ޠ@H {wv}A͊)}+DWSʴVR-` *.TH:k<͋N۴Ov8/~R-,,t/h AA]?N 3|"Ғ ô+ٷ-#r&`eVr* Ja0nAÀz6 9?9zEȇ8Z(Q1ٗ]D=tc}=uKKU7^ޠ R9=BLsR?gbpHw1 =w"DDVzW' cx :9‚*wRCCǢw]}@-*pD;JL("ݨ-LY$I2&>=> "dS$Rꙙ"N(SG]S$ {U$?hbx *zǑXSIH:u2S~:v1Mz?'~G`񋔜 q|i=J"zD{4O˂w\*Sd 鮤>rh} &P\tG}~[email protected])%%et%9TDPG{&D>(Q;$ԺTXFCM R0#?"@Gȣ W"KQ1~YFNw_QCa/?="+>_wwn;z^!="?W`1AlD#JttURQN̑8z*b.J(uJqg9RI]UHaH !?Ө>(D{ED`"JX]dzRAD}@=_]Ҿ"`S"WSfMӨAdt4hY~ueeɈmǠ}LM'fg/,q=<PGק70?ujc9c{<:^]R(^;vONjw|LC ;" ?8v*VS}{ǂpv}g3=*~Q*X+ 4=SuVT2&(w"ʟPe({ǡۼAD/x} Q^T! .].cfI?)< A6hTW'(ɝ%P*5S0DQ%9 ӵmQf_!7SaH=CRp}<|ݐjEܬtHʚd0i$[ 0B3A5F! Y'=z:lDfԠwN+h):TJ: @DP)Ve g#w9D;\8p.UeN>cX{[email protected]zz|OO;^W_8ms}MqĵXu_h5\J{CN~̻FqCfIQjCCCF &[email protected]_o٨qNoP.~'Q oz;D[#נMC.ONCvTgJNOH>b bC:fz N.ҙ@AHQE R&e1s@!PG8C>2T~" "QuDt;$Oݒn"1fQ -Z xeT,=ts=?!:>/zp l7m\z&vzL=1YU,DX&P=]8X;##ԨE6gtAQ4m&LWx6쑳2$j'DH|wxd5^nUC {A`ߦiIvQm1w$QK Ω%aZ޽H%ÍԻ#|mK=0rGsq9 e F ȏu,Y3JF] bRr?]+A 2v hG%~9q38u5땶*[#;q7i}?'i,!Xnu²r1{ Ko4R<E^ ;]#.PN)-preGM"uj祅N$5 }Y.EVHTM!0m.G$kMbj`o7LI'.}_3hSgJ|Ō _q^KWxg&tcZ;[^ln\2zJ":t/_ },U*5)2# }(WX^bePEܤ?|rQu7!P) ؖkzDA CP CSL"aڏ9!xZ#:|HV9A#-JE,-_JȢ<1<:^>m:7~cfjU9{L~1=yYT1YsH]Ԧ !#*BV>ۻjOب-3A}cd#J3:2Q*xx<lr pSPP}w f' UkKDW[P7m*:))v:*̢DQCLsD0=~`?'bw."b5Q#bD;;xm5}Ɯy0>!<3#?UGc-Rea'OCR(5l/§7A@W3vUl! 5S>OSh)4B$SȠNq.G wwcuyHe-:@*^67G_uO?}#>XajACXJ,$LN%W 2o$!PMVٓ4 6ڤD(JPB& I1w)} 6u9CxSP^2n\JAL{b_y6i&^?GҕrY~2r3@&?E:OPyz+a7sȇ_)& `aGD h ~(o.">#SC=U $tK$%& yʩDCwihˏ_  >0$s&;X`7~D,@}w#jQc+M/]t"=;|O1bR%9G)l&$ͦ+ؽFDML=۬Tg6&wcw&#ӧEM`ZB=B7zrMLGP152 8Wngorۡud*W#ukΖ*Gvs"S8Mz><_^P?x#X;.@?v$գu:X-ۦeVP!D~{y'30P'\d} b{E{۠={CfzA `2`~,$I=_KG?Oz>G}G_V+ iVQ2 z`޺)TS]No,,HbZx"9.Cd)zq&9G{G cl%Nz@>CPuN ByT+y|@URȩ<*&=?7e)"ȷLW75@.CKÔGb0`?;{ x ,x+(^'{tvF<Ii_ >gN_elHs_rW+AӉ_31~#RQ5T(ȩD{3#tvL#Wj2nN ?]ċOg9A"_N6305*A.f2pMJHQ/!n&0S/ #tȸjzf+fKV|tNrp)1֣'=2GB;ViƧLdzqz=c@G*CTMBbGi(ԤQFEm!vU>{czG7;}#ǼD~u?^L?C>G_O?/(TW(ʃ+ҭRwlv90,Re#!Rx.Wa$o_XhwqL~^pCGqHNoo\|x:FegdpRE\ 9uqG׶L"NHUk.)i.cpR!)嵫I!M#rEJrC/iU2VV{Zj-qL(KJ؛5 |.#&f *kEܯr,cKסeGGM]T(b3xRXS[G#3Mפ[u|\nT]rҪMIm8E7۬II9ysW"Ɇ&,b R\iUJ x]"2̾{Er+kG3MAŃ2x,-ݜNT( #9ѯ~`>}#S9RE2tZ匀4Niɧ*KĬerc<Yg7K'ҙGѤ8C,סMd׸O\QvvqԐr':I&W| *("+09[tf''a(}PB9p<ˋS)zB^;S7s]-gmWV6],Taa9fd*vw"Uؒ2nAm*7DG ctT4bYUE3MSye񽖐P(~R'cd~xuKH)MM"SrDC)q%(wT]Ӄ9@P_B(巐t[lY#SSq=J`n~qzЯ<=|(BM,=\)@|U*%h %~T"LՀb#y `/J50==1C |@s"ړzD]7NbR'Z*z `BT^!{$۸9 05t"P(DCǿ@ST\( zu pZ>T"ݗ?T@PZM!?Q/wN*02 JbA'pv[email protected]H` BoP|MtQ0%P讑dLQ3؍Ѭm R=m6Оqrֿ9F[email protected]D LƋ_+׸{)X,uS!tǧV뗪+n@Ϊ WfQI:!ԲHH U)ɀ:{RInYぼ5+ Nj OٜSCzu֋v)3(q1qHB=:obaLzTb(H3.S7$ ԽԛT(AݛdF(:2;Qv)ESR3DG =ؾ. @QrpD=~ A|~_ x~|ۀQba;n-, = 2YHtDzwz<>Gű'XUI%@@7=?XzG_D;t=Cۧ۠wnStL.ۧ^*{4X!qmSuYaBaC; Y*r$2b¡蜦䢳ZoͳTS){ Kkl;w%$ް* qWYD59i_\y#ȺE^jo|> :R.F\Sd6b$*ek 2~NZvI_Fo|'iv*ijq󬣲Ԣ[a!g6D77wNJi/ S+.6HI;䭍*UۼAӑ:iTD +,JMKg6,ىr#JfJutnQ3>*S<"'go)wx|RUޔ&Tr ce >Սpt,]2qU\~(T?8oybJWYféTHpmגZv­ҭI_!5YMԪfj4${:61_ |8l=:=bYqbRN-^JrnR7˜՛37]P|v$FGnC/ i%L&0v%r+'Gu*mesg( #"J a2iPnSxj1&v< HDTT@J.hrE DzzǨVg Sce(C|cmH޳s(& !WHJLw6TdS)IjLR tOOױgXЩ,"VZ8DCk4q;MAUH8g^ rקi_P0Tٻs{@csmyx9'#%3'o:KxKRCtS|5ޡ'Eu?dWb, $ƂM?I<7؋B @%I3O ,0G9E27)R%eM&KW T 6zs:z4V=рgWR.@lSXKv/xNC&BA&&IC^$PCv)PX) ԚE ]HtP(wcgPvI =C8rC1<륅.C9ErQ8ucCU rTG0j?bXBD Q"E:S{bG|=WwaMZA`@n>zTMԞ7pt[email protected]{=%L'Խ:Dt;OO! A)JT3t+:z:]݉7?@HtBרv8mB);PPs 0tC`觎2[email protected]{Z]<#?j Pn]^{)SP3u"` 8QŴ78 (zw0Vq*~H҄q Jx 0m`?]Q:RkҗfQqKu7Y_dMc;c| fC"׏ 8noZR F<,ģ6F P)tdxW\du ~ ߢ-Pۣnc /ԡ"@vOg<t[ѽ^IAp@E6_N uQ}TDAtzAۣVL}~[{%p%-UGF.ԏ < : =>~޻ڝqP~}zv}C۠z( z~]݀(ux;zv޾O_o}}?P_8ߘ{~o_OO4uj4$NP:UqkG "` ֫פ;W‹G͗nS'}Y3$:Zl̿ f:Y ^[aVD'7%mڅ{)kOari;Y2 T #XEnIf_1m $*tV [IĸUv(gIIOR+kOEe- o7'.(~31 b=xqe:g"aR2ډH:! d5´15y(Yn>%;[[email protected]nYj5QT8vٝv-W ʫyszvlЋ[}Tó?ehl*=V)' qk<+sD mUmbK2Vl})wσۺ=p)iQZ>eZX1,杦ԉ`Wzv{^V>VZ뙫Z,&D=d.A>TT+d.7!hjcF*ξ9P3S0ȺU:m3ulrn}cǶT=Irrnյ˞[A[*#d{brQ=e(B)+x NjrϹ;tx*!! iͳ 9+lxP닒P )qT:bVyKbr7VҴzcju~TaS~yF#-T?iۋJ*.B2K}^sEq._HϯsRJ0qYiKNl0RE=3Qd|if Z>dm:|FhY#7Pxab ޱceV+nWmNx=4mkGg)idbbʷr+rSn]){cZ2UnŽ[_57>ZEHtΌ\bd2EUYul QQOh PޠaZ,YğsM3D:E5:mN f9o1sDkD,A39G#VZT2@!:==ð241f[email protected]@`<&>C@#3A۩C21J"d2j@ cq/۹ %'w_lp0X˹U=>~"Ue'uu'!G \]{/@h{o2JRA~797^U=zjQ.ImYX%5I4s?j b: EP{u0/c;[email protected]vEgZj%AFɼ0O*??r\zR%0u(M^8 ?|*?x)*igk NLD(#q00S1b!"S)`__}^:њqۅen(t>ExH9R"+"~E'`Cfp = vjW4 lʓ9pGzf : Di7"$"i_tIyؤ^a?<ş>sW/QyU"P!<<=>~??={zz>@zz{G_}_7|>|۸@"?Ot}cw!C;t?X~޾\?hڴ)fT퇊0X43<`b#ް ձ*bnm7rDyY ڻJ "&udf]"_d ,T|xФLAt=2Lv֜?eh+E'TVNM"_$Pb2(7^?< r`m&]C=7S#>9 ޲y"Fk;[[D(v'Zb3pNdݺy X/.~ʎXZF#­Ew!RnòI]\  znI|?㓓 |S>sUD1Tb<5hu,`*b>j3_2;?ڣ^>qW/.џaԊ}/l0FE!8w_$bږi!<@E x.Y-JezvY!˸։:!ERrJnmlDZTX'Tjs 3rbqWFP"sɺ㚓)#1&.gW2,}.Tdl`𸶵~|#o^~,yj0zFEM߶9䨱XˆĠ0Ρ9=jn9ޒZDh&/B֭wSI!_nG *f8=~,mrwZUܲ Vr[T%b7lx"ͲFN~4vcGJhuo诶O\W#涴c MZ8%.{cֲ g%bU\W>H2(L{2]fɢFs*6twE־e\ aۑ&%CoM4[rfFLzܒO)pt%OjY=]~Dv <•cGݖHy=fmU$'HPl/ɦ4ϗg2 7+a i;5`QVY\v56S7O-ݦ`8ƫS`vy™O$Ii*=­۠^۴E"ݫDJ!)C1(ZVF9I$s> ^-xDw DQj8Μz ho& &%^?`e )촔>bk"~(@tMxG +Na)g!*o0HbDD;x&9cG o[]y3zfStt(ÀYu)L=DE p 2\f_Y Z%H=+RG*vQUNc̢01s scz5UDDK"s&jzP)B D."&I_i%Jؘwv+I6O5W ǽO.Q8wz7~Gz|G'eS_#Q\!ԫ N UEddIBR(b`+󶇵(o xD:9B<,d@< ^YeZ;@PXJg%0wz:v/ ~~HuO_+W\-I&b˵R65I|\U]9ScE*T= wfubq(݂w3Kθ8%rh JkWn'E9Q4=plIlɖ^`k*+:o~)2خDL٪9KH` /Dr+>)'##,_}5XH֯@hQQ"G>kC`:Kh[email protected]~⓱ǷyW~5<']05rNBWa2KQxGYIN!![nҜwqM$'l* 5 ԧ(M-2J=9^]ҌPb@Z7z"Dv'2xC3%eAtJe]C(TuئjZP\Dнشk1е;%K2/sE@ceeMW'%/CuB/=q:U9h&oIfm_m3bՠjfU#Rz_YVfdm/hcZSԊ'z='ZD$K uf`n [n eZ28P\;pP!D؞e-Ww3مO/4j7,80]dXvO( L:|Df8/qޯ-MM+4 ,r6v}=Rl)QU$oZ3syM6й(JDNU%l\ρmt-UH#(EE2(֫KO -w=r3Aj*A:šF32&,)*py}/g**2Yx0poT{ABznOY4Ѯ}oAGoehe /&5xW5InXˬ5;[email protected]2*ƭAT;Rz^ fY/kdYpQ$QJ_lͲ@E*.}_q"@_wgU-s:\%C޲Rk\L+3$LeP&Cw{M۶@'ƓNX4)=a֛`&[:yUa^VL:rؑU Cޝi'W3@y.xUQr9Ta9z>bQ#e1(P(ĭt*8UW E:򿗷@żK٤H1Aj;(=_+S"ry#'mLDI4JvK<9>qêoרp{+;Rt*AzDI>"[email protected]R$pzvۧuG@og1U(lwx]B@#wwF*9PV""# t#$ԑe$TQ`1!>?da$Y$J ̢d:}d'9y좤t3 ;WCn vz:?%v-ON=?XzG_]C6=c2V/FWT+4VJӉwl='KWIB3MXt#\Uq;t m|WC;)6)\iV^1-ɲYb> 8pJkuWc5R_xv/`_$δ53d+" u(t~&W4>l MULylj6楧]S5|V901jiPtt]S HN'1owU(/ϑ٘knP劵XP%XЧ27 JAI_ s76q[?7\a.SDf}B'G?q\VF3JRg$x堽A{ui~CboOק 3TlLNmYT\RJ7 }s=YƠM)cLs)qz@~&mIFL /cfz]o.P?c_Qd9B[\#4IF<$.*Eve>in]MG*9[Ve%GSH7)®Vi:?0)|rB[vz EXsKqP T :h$:N6q/(8*ͯ?*wfW=o_u?d%gld,-^]o&eWƸgxTi5$yJ/Wm7#fDY(ݷvd۩[̳/M }!~#8d+\sY0ť,X!ޭ& HԞHKвoկEcJ#2f}>hOW9*80B=:1;bWo:F^XTV cE' /ZXݖ߮q&bKE 떊Y=-sWK.ƺh'Sn|7~>Yک[>/X(qk 7HS[BGH0rQ\۫ȼSf-πJ-ۘ5 7y5p (;l{g _z_;nj gM=4jZ><%0cO#1VL5e'Wi_6q?˻ʕqH{:G2kBFI2EQ c]@ZSQ/x覺2xn"\>/Q!Mt?j8r= jqZbe^]q1L `Cu=;,hT4#el 06&T"oi]&^u^ΒR5d :Lobnb$L @;#at;SF58&It"E <=6I2X9lc1GBpv#ABxDz_bܒCՁwWe0R`˧ҫ5NN_»1sxAu QO0wk#Q([email protected]:PDLG&QS ԠJ:8D:ʬ{.Bk92~zA~`whxQ@ SȻ'_LjBNءR_$ug%1߸uLQ;~_=v_#~C__WP}ޯ?}}{w.0/o?vx}_-!"ɸ6M_'Upt$n@:% xoͺ4%h kA0 /TATk,#/P *6=:N]J FT/PP/&$J:ߺY҄/pi0$@Pڹ RN%"0aAT0ڿft9Er eЄ*P1ՊШ:2ǡMG7QRUd`1LSIB CD ";u>SȦ]'5yFaCA}b ޿BH"AQe")&_:B169N m O̍uxqU1q\ʉ'G>WQgd!-nPIBA lSc\E.ə!݉(3u mfؔUl{<]♎Pz:~Gzv4fZL?4G7x;7P %NN4X ~;s[email protected]𘊤p p2N^rXv7'a4\g!R4JMJ/aBV?n[EPX4۸k/tJ43s@_vbQDYt7F1sbx-:dZhI,1}d!^sN9&E Qp98vW![28t3*==GL"H7t8R/p!vPP>bB7_ۧv#WoOA}Co_'/_o_I"UT04)0!LsG{݉}Al |#Z L(s$F!o~OS*t# \3zð1Y3)RAtፏ#vP3z~JL#PnԒ6E Qw$:]C($LDI>;P fB ݨ1Չf<=Tw^:GVf0>&ee@*AE"雒} /x?ۻ~z1e_OgOcMC_OAr@$ -yȤpq\j]=F>~*(sSCLs1n+O0TSy/L#䚏_IjtGԣQPa1sOr:\gECtMDHMT!U%"Sg5`%zX:z%,t+>u~rr ̚a!"=K:(y;~:cYpʉ:S Qlt:!U2}NJk$1җFeͪ@'V&R3gH31ʚu:E"'n+>SgrmڦDРiJ$ aՔUzzv>>{Gn/>>1ob/ARMbDc$=D&7O}{z⪥ؕ@\O=LH`r0"yMoS9E3-2b#Ԯ']*={Ǡ^]9\&:˨uT0DDDGwuǴ]E02rOkԦ+ jB-ЬGԻCaV*r1nEI]1Yi†<_>8P:*aQ>҈54ET xr۾`䟳r;r@@>OwW A(9\9J>~E[T4EQ LmD?>|tdA00P1LQ?8w#;HDZ3 1\uwzzncn`q~`,Fw,&w"~╲&@u}z2+x#_ [f z⧕rVh;I`jإvE!)@{ /$MUIe\B8򓒏QD (UHJHJ ^=չY(rf5䒩*Yסj̢"~B^"aoGO??z#~?/?OnޯG6,= DR:0)bV kSfL;#;t={FjYh?o#)l? )~Ж"Q:Yb2%7ٳ*٘MMU0&7fsfvꩳڰ,?IZR )"͒2_8*i9@OBەtf6qM+ȉG*0UPqIWAt(n ::)L:vgIGd0ub=>?܇?>v7!eo_zL:KׯO=֏(es=֏(es=֏(es[m"# u윔vzr+Dr. >GbL[^兩Y=aș s>*-'vfamw')ğtgP讥tLF>1qcND6P~|UX͝as,2Ŗ[q#$m+fqVIɇ*UDTA%LJI2!; db7PMUފ;}o;wtuY]Ǟ IV^ܤGCƂ4.P_ )xb&aHvBa)_<' :J-* &VMhz'JO`B$ _YPBY`L[kVuO*4!̪I\8'>:VfP,]JrSpwo g[>JFٵCD H* {)xUa&V&wH*R,9DJbNG>9bQh"]…I2 GٴLiHotG(NMS!+}F~s{/G{tӱSL9 R)@DD{&1J" 9L/`Eԣ$QvuE1D9I_hz^ Qzu#bPz#&1a0DcD B"#""#؎do@crtA7GMg^/){Z.^n14H맋  [email protected]Hyt"6mݵIU\UnG9C׷Y ~(EڜpGB"d7ء F79}NV<ԽJq&f={&kD pkh>dİ-"!˻]gKr7T8O_Լ2J =: e;E~MSOUʺ\yH; =; HKh(&<"ZpQg~r:B!E:l8cpMJ3#t4nH[4"? 7^#VvN.*`=HįqI/)AWn.AkST蛔GT78ޚ9IF UAI:Ҫߠ~* PDIHZY (IxݩL 6I(sD:RzGwnǯQZFc,tDB~UND: xN`!@Y)4i @})`%?|usr+Gء%z#נ{@C_P3h_Y\%q,g˶ EU0ENe9sc=Gt_:}_' cjiԂ') #תU͔84{!f1I5*q+IB&V1؈/Lpӯze,t+@~rM?ѫD7VtSy;Bol\bT!Zec SP;ʪ‚c!Qb1!HiF#`H JnATɴnM]륔8㘩U9==DG M|Ei?~N _)}gvtz͌|70#"&h QS80YuT]cSΪ΢c~}cFB&p]ҋ(?On>_?#?}gq/_ a;GgmT1a |= P(3D=auAHS2\"&P{F鵶$Lg0PdZ=c%Y6_Y'o__9jyj̈y n\81m'5殛:$ XyvP\PXʴf0Q1OQ;Fwssi$>Y[UI>ri'8:[email protected]=G}_'vEItRu;jv,MB7o2CODV[$S6XףE}IUUl%ۮY ɪSp{4dZ6H? e>G=XU5N)P|hv,sGP: # 쀈D~=t:FrQQb[email protected] 3Uݢ'jʸAKS1s;+J*_Sèt#}@1V2lJ("P387EO^0~QGwOVH(wwQ@C N tR7jERS(} ǼHI>MFm 3`ܾ[8(E[email protected] R#">PoPvMF;tRlpMu?`v#|uUVJ.Na0ruKV$zxgdFMYKϡ"C*^aq3$E_B2i^D$Bz|zPAbNL~4Cu"mceTI>?P>7rnU>GN;Dd5TC rwBy1(<c.%Eb =H2!U[ d5+o霦"Hg)g!`>KBV-Z!S<~Y=^e,Ө+=Q섬SKU9bCBHTKئz(M<*(DeglLQilc$(* IUJ`)v;0Mzs Zƪ/0jbS'Ae9!{dL< TKӠv=Pz~:z,}D+J11{}AC;uz::#|u}#zO_ۿOnZ* bTE4(trO9aM01=݅*z˗Moj0JaìFGº*~erǎ ']ӕNGSq^vc.؄X9Ek&vܗퟳT(~~hӝh)fLW)NK?=dlzdMzNHԲ"&-hxbR) GHµ C8Wqs' `^ZQB2}DY`ܟ:[4Q ;8: PbSv{[c[d£ T$1NKӠ{l/0_/PQUĢ*Pc~ZW=U!u9qC7ˑD?HۼwMel!$uTAtԊbA[bNimail protected] ":w4tlib+V QNFQU%U:K&`[email protected])=~BnI8!HPNL E|`_ \ CzPU:-]F"i"i %7kGP E]j1s>I9,[email protected]vDeZj%ÙBW 3:~q8uWOOx{5hɎ= ۬^ r'`5۰@ oL`{`*EL=A'w@{<ڀa"lYק9tT"Ωc[email protected]{GVN6+A]v)#Abh A6of;_0DSО!!|FR]w}*%3{M(u?$$IaQ+GS =A^ <x0W ށ!(AgPG?t?GOOu?OjN<]M370Zqi'_}CtW۠o|}_w>GA}?#|ݺnpp"-$eU9JР""=׷uD3!^sG&f<}&!![email protected]ۨ1fYzLCz `cz=DҐa8 84"_ڠuWHtE$LnD1a&ZmuWl'% 4 %7q "$fASq/ P}E( ~=>J1Rw`T͜9'"S* QD=CC-i~Aζ`3H Pw 9>FRIUY@QnDġ|dAD0OGP=}Q~n^2|=2>Ȣf2j$rQ5 =Jt 9D:M9 S")^c4/OI(I(zJ\dDB/GXSL :H^5zvQ0VR:+&r[email protected])@{*r"s^XJErQIt\Qa,듂j_ d(.[email protected] R351Vi\ڝC`16;h:](8N,̢(ǩ&9?9aG{t0|WaMs׊wu+v*?xz{CM0$l( C "?Ga=S qrjta'l4:t[c,ӆ()CdGөGF&YJ͝ʽz~eAv3w Qeo "Qd>Dzo=ҪTzCTD}b*,cz2ndL;\i>x&&G1:@2_MD;MjJ^VMIA BuAdLջG=XŐ:w{+Btvq1F4L0@=CI6[email protected]8J=޲pPRE2r )V"E²&(Ru_G_ӷOD|jfyU Sa ~`O( SdD{$""?OSNA{t}:~OP~_w?쌥3` =e1jPW.̊"=]3-j bnQl-.vdH0uA E B=Acӄig%tq2nEzۣ2"Bʘ@Ӳ m8ZFMeКHͶAo*8"S?GŦ%nXd*"fcdUpT |$GDK v$EZMRu(UI@.Bt[email protected]K3LYC0$;ٷj`v,>%:YWV7ʮ#{|~?o=Akt<Ŋ~UO_ͣD1P9Q_]ݻG(FSF\{ɒ}6u &A̳pLf/QٖmOU18yN₂c#v],Uj$UHJ=av* F@ɨQL`v5+/E9K_8+))H..6vRj?Pc#SY/&qmRzB=|'7`4\b_9?H *:dgL=]|Q뿒([email protected]?n$B^Po,}]3KJSAwTz+=}a*7RJfЉHBؕT t)"3hBFP=`G"`/Fx|AԠC޲/NQI:u0v0Q"#۠vYB (($~[email protected]&?T>(zxAH$Rx<~7dxHG1D1L?PzP~]>G_uzgfGFӯBhF1/^:lp)wvΧo=^ް:no:_'U(W"}%;)OR(U^L~]?`Wcw'=ݖx89]Õ(acc?8noR{fdy#, Lg%D[*A&!KX"P D9 N==]7vA)ZCHE!$F"E9\ҍ(ȘJ= A0j0:i4/NV7J$X)4)ȃ8B6a5s&' LB>rۉ(M=#[|P}]>~_%dW3˔fTOcԣ=B( jʓ=שo0tQJ/([*tsd3({LIArD֋f{͕4ٻf(I/p`%[a_/k4$X䙱ݕv*TnYlWK8DTX+z<|eb/wN2ju ɵYbQt+)"SB@aסH^0;TkDr%y&,ژ Ŏ&MYcJ9ik**>V م<"&F"j )$$1zx!>cO UH=7{AF`zuLKۤSh8"hx(^S&#U Pznz>)J&1 R1= RD0@R^Œh S. %0'߃@ɻ!^(C~̟S@j)݄Mqovyw~^ҳGJQ[email protected]/-Uz H񈤱{" =JcPvǼ ƍN"P(E@z(>:C@>OӼwDC$D2(qD L?>TmkJw8l.l}uhxz Ě~O|0??~Gv=|~GA}? D#ؾ~G.;%)qzjr*0^,p0DL{)ZfJ"˦aRbS?d"\C5N >0Om!Q0ӲL!U1X`[)zhxRn=;t+{d|3!7A __jQ"w`\:~~{ Hʄsq06d="@Hyg>ˠ?uuP:vP~G?[email protected]""=>qOdeofY2Rh%5$STג?b&0yqtE$\$y=*5??\X%"#zvE`L lRɘ:fPQY @\;=zAۇZ*u?C\"_ɖ|QV6UAI^)Gkx*ة.%\AI#`^gwC7ӮfdStQf<ò͘~`쳅Yª,^%8u1}}2@(0JP&0=cV(*ndrX1OTQnmJRZoE'WEs?Z=?VڧdcVHYWl%;*bEĦQSptΒ4#A@;Eġqf@*ݏ왃LPTS xyHuC´$ 4I>cCzbJT"khW DĠf3BCU`Hu?g$"g|uW7L]:0q OɣL+!c g7D#̔r₪:@M4R:GQXuEBFIH:qzʬ}Gz:v]B@JV-CxH"]4aȪ=Ԣ=Xc $5$ ?Xr1z::?)*pS?xKMTn,{DDDGD}b"=۠v@{t==>o'ܛd+;J7ic?0ah{_}R {x=~7;hTPQenݼ/_)ݝT4$|,ɗGgbЕaRAdIXTti +V(LEr@C~wy{/|<ޞt$,QZ[K*q clU%0R7_4gQnȲաUbg{4I.DNU7n(2z4<#}Jux$ K'D<[7 y{k޾wtoO?ٺG>OMa⇂ TA",Ȭ!Ve)L`0 W]f'31fJ4HR:ӿUذ,b7J;EwX<+Ns(`X~Gxo;Ǡvc2I|8F%&_&$,ʤs1ʰK('ۼ{Oƶ+gKD΋U"]E3NiR84z=^WȗU4! С:AV*> qHE _#@:u;wz?G` +vIƪxBW ;p b.wP0DCDgS?b&_:G6-eV&g(d+q10)?!GG{ 7[\ y1M+.,('*RKUQa3#W*" G>6fVVXA+]*U*"1]ϜYDq%\s"WAY+qv{ YV{ Q7ĢeHTVpU"}v~e!nr$ٜ@xN0{#0ɖ2yↇj6|c؈OQ/B,,Ȉ2$8,~#/23|BίUhkNe Wc*n6In11Tro*>,)t[DV; 1ɶ9Fcc{l62#M\Z{ԢM]@h 1({C.Vŋh/1O45}I k%m=,{ӸIrd*j+#]+l/gMPR0-UjڰXZ%033'l@;U՞av~[}ڵ@ Fi43(sj=%> Ed[email protected]Fip` ?OV~`G{BIvz*DH*c•y5 U'#҉f0TV\Em:mRhVyb U,*.)CNI]"QAUH쬚,cx&8ӯyZ冣S6}їIn'R(cI2uopo!HIeHQP7· xݫ8nD׏V KLFCuQרLKV?^&^j4\lrpާHբ0ȺV?1aFu +˞ihSYC!hg%n1_R+ERJEV2m&k6='={U9BQ)Ү2F{5}+l)qW~8,,wM 9i8!n~2|̷3C˗QtFÎ:AUu: w~9s 湢|6.5M[QС68MWWqΰҩ"<lHrXzf|'[V]31tubq;[ZWۦUQĝ~W`tڼI$?7ң5X٭RaukrȪ**r+/RZ